Description :
From Genome Similarity Track
Location :
Scaffold_777:1343- 2485
Transcript NameFunction/comments
Phyag_g7974hypothetical protein PHYSODRAFT_252207

Sequence
1142 bases(100 bases per row)
GTCATTCTCAAATTCACTTGTTCCGTCTCAAGTTGCTCAAGACCATCTCGCCGACTCGTCGATTGCCATGCGGCTCTTCGCCCCACTTGTCGTGACCTTC
GCACTGTTCGCCTCCGGTACAATTGCTGGTGTCCGCGAGGAGACCAAGTCCATCGATGACCTCTACGCCGAAGCTGTTGCCGAAGGTGGCAAGCTCGTCT
TGTACCACGGAGGTGACACCCCGACCCAGCAAGACTCTCTGCACGAAGCCTTCCAGGAGCGTTTTCCGAAGGTCAACTTCACCGTGGTGGTCGACTACAG
CAAGTACCATGATGTGCGCATCGACAACCAACTAGAGACCGATACGCTGGTCCCCGACGTCGTGGCGTTGCAAACGCTTCAGGATTTCACTCGTTGGGAA
AATGAAGGCAAACTCCTGCGCTACAAGCCGAAGGGGTTTTCCAAAATCCACAAATCGCTCAGGGCGAACAACGGTGCCTGGATGGCGTACACGATCTATT
CGTTTGGTACCTCTTACAACACGAGCAACCTTGACGGACTCACTCCGCCCGCCTCGATCGCCAATTTGACGGATGCACAGTGGGCTGGCAAGATTGCTTC
GTCCTACCccaacgacgatgatgcgGTGCTGTACTTGTACACTCGCTACGTGGAGCAGTACGGTTGGGACTGGGTCACCAAGCTGGCGAAACAGAGCGTC
GCTTTTCACCGTGGCTCCAACACTGCCGCTGACTTGGTCACGGCAGGTGAGAAATTGATCGGCATGGGCACCGATGTTGGTGTCAGTGTCGTTGGCGGCA
ACAACACTGAGTATATCGCCTGGGGCCAACGTGCTGCAATTCTTGCGAAGGCCAAGCACCCTGCTGCCGCGAAACTGTTTATGAACTGGGCCCTGTCGGA
GGACGTGCAgtcgacgacggtggcgccaAGCGTGCGTACAGATATCAACACGGACAAGACCTGGGACGCCCCAGAGGCCAACATGGCTGGGTTTACACGC
TTCATGGAAGACCGAGCGAATGTGGAGGAGTGGAAGCAAACTTTCACGCTGTACTTCGGCGAGGTGCAGGGTGAGCCGACTCCGGGTTTCCTCGGCTTGT
ACCCTGGTCTTTAAGTAAGTTCTGACAGCGATTTTTGTAGTT