Description :
From Genome Similarity Track
Location :
Scaffold_36:134295- 135550
Transcript NameFunction/comments
Aphas_H257_12051Hypothetical protein

Sequence
1255 bases(100 bases per row)
GTAAATCCGGACCGACAGGTACGCCCCCACGATTCCAACGGTTGCGAGGACCCAGTTGACGATGACGTTGGCTACAGGGGTGATGGGGATGCCCCCCAGA
CGCCACGCCACGGCCGCCATGCCCGACTGGACGGCCTTGTAGTAGCCGGCATACCGGCCCAGGGTCGCCATGTTGTCGGAGAACTGACCCATGAGCCAAT
ACGCCCAGATCTGGCAGATCGAGTCGTTGAATCCGTAGAAAAAGTAGAGCAGAAACTTGATCACGAACGGGCCGTCGGTCAAGTCTAGGTTCTTCTTCTT
GTCCTTCAGGCCCAAGTCCAAGTCGAGCTGCGCGTACAGCCCGACGCCCCACATGATAAAGATGAGCACAGTCAAGACGAGGATGGACTGCAGCGCTTTG
GCCTTTTTGTTGCCGGGGCGGTCCAGGTACACGCCGATGACGTACGCCCCAAGCATCTGGGCGCCCCAGTAGAACGCCGACGCAAACCCGCCCGTGCGAC
TGTTGAAAATGGACGAGTTGAAGAACGTGTGGTAGTTGTAAAACCAGTTGGAGTAGGCAAAGAGGGGGAAGAGGAGGAGCATCTTGGGGTCCAGGAACAG
CTTGAACGTTTCGAGAACTTCAGTCGCGGGGTTGGGCAAGTGCTCCACTGTCACCCTCGACCCGTCGTTGCGCACGACATTGTCTGGATTGGCCAGAAAC
AAAGCCGAGAACGCACCCAGTGACATGAGCACGAGAAACACAACGTATGTGGCTGTGGAAGCTGACACGCCACCGTTGTTGTCAAAGTTGGTTCCGAACG
TAATGAGTCCCCCCAAGGTTCCCCCGAGGTTGAAGATGATCCAAAAGTAGGAAAAGTATGTGCCCTTGGTCTCCACGGTCGGGTACGCCATGCACATTTG
GCCTTGGGCAGTCCAGAGGAATCCCGCGCACACGCCCAGAATCGCATTAGCCGCATAAAAGAAGTTGGTCGCGCCGTCCGAGTACGTCTTTGTGTCGACG
TCCAAGTTCTTGTCCATGACGAGCAACGAAGACGAATACATAACGTAGCCCCACGTCCCGATAAACAGAGTCCACTTGGGCCCGATCACGTTGACAATAC
CCCCCGCGAACAGCCCGGCCACGGAAAAGCAAGCGTACAGGACCGCCGTGGCGTTGTACGCGATGGTTTCGTCAGACACGCCTGCGGCCACAGAGCTGAG
GGCGTTGAACAGGCCAGGGCAGCAGAAACAAGTGAACGACACGAGCAGCACCTGC