Description :
From Genome Similarity Track
Location :
contig_66:134266- 135718
Transcript NameFunction/comments
g9588.t1hypothetical protein

Sequence
1452 bases(100 bases per row)
TTCCTCACGGCGGAGGACCTCAAGATGGCGCTCAACATCTTTTGCTGCGTCTACGGCATTGGTACACTTGGCATGCCCGGCAACTTCTCACGTGCCGGCC
CCGTGCTTGCCGTCGTCGGCATGGCCTTCATGGCCTTCGCCAACGTCTACGCGTCCGTGGCCATCTGTCGCGTCATGCTGCTGGCGCCCAAGAGCGTCAA
AACCTACAGCGACCTGGGCGAGTGGTGCATGGGCAAGTGGGGCCGTTGGCTCTCGGTCATCTCGCAGATGGCCTCGTGCCTGCTTGTGCCGTGCGTGTTC
CTTGTGTTGGGCGGCACCCTGCTCGACGGCCTCTTCCCAGACGCCTTCAGCACCACCTACTGGATCTGCTTCATGGCGCTCCTGTGCCTGCCCGTTTGCC
TCATCCCGACGCTCAAGGAAGGTGCTGGGGTCGCTTTCGCCGGTTGCGCGGGCACGATCATCGCCGATGTTATTGGCGTAGCCGTCGTCATGTACGGCAT
GCGCGGCCACCCGTCTGTGCCGTCGCCCGATATCAAGTTCTCGCAGGTCGCGGGCATGTTCGGCAACCTGTCGCTCGCGTACAACGCGGGTATTGTAATT
CCGGCCCTACAGCGCCAGCACAGTGAGCCGACACGCATGCCCCGCGTGGTGTTTGTCACCATGGGCTTCATCTCGTGCCTGTTCTTGATCCTGGCCAGCA
CGGCGTACTCGGCCGTGGGCTGCCAGATCACGGGCAACCTGCTCTACTCCATCTACCCGGACTCGACGAGCGGCCTCACCACGCTGGGCTTCAAGTCGAA
CTGGGGCACCGTCGTCATGGCCTACTTCTTCATGCAGCTGCACATTACGATCGCCTTCTCCGTCATCCTGAACCCGGCCTTCTACCTTGCCGAGCGCCTG
GTCCTCAAGATGCACCAGAAGAAGGAGGACGACGTCGAGAACGCTCTCACCTATGCTGCCGCCTCGTACGCCGCCGCTAACACACCCGCCAAGGACGCTG
TCACGGCGACGACCGCCGCTCATCCAAGATGTCGTACATCTCGAACGCTGACGCCGAGAACCCGTACTATGACGACGTCGAGGCGGAGGCTGCCGAGTAC
CGCGGCTCCAACGCGGTCAAGTACGTGATCCTTCGTGTTACCATCATCGTCGTGCTGGTGATCCTCTCGATCATCCTGAAGGACCACTTCTCCGACCTGG
TGGACTTCGTGGGCGCCTCGTGCATCACGCTCATCAGTATCCTGTTGCCCATTATCTTCCTGCTCAAGAAGCTGTGGCACGAGATCCCGATGTACGAGAA
GATCCCGGCGCTGATCGTCGTCATCGTGTGCGGCTTCTTGGGCTGCTACGTGACCTACACGTCCGGCAAGACGCTGTTCGCGCCGACCGACTCGGACACG
GACTTCCCGTACTGCGACAGCGAGTACGAGAATGAGGTGTACTACAACTACA