Description :
From Genome Similarity Track
Location :
Scaffold_13:13422- 26213
Transcript NameFunction/comments
Phyke_g914conserved hypothetical protein
Phyke_g915hypothetical protein PHYSODRAFT_362533
Phyke_g916hypothetical protein PHYSODRAFT_532795
Phyke_g917hypothetical protein
Phyke_g918hypothetical protein PHYSODRAFT_532997

Sequence
12791 bases(100 bases per row)
CTGCCATTGGTTGATCTTGTTTTTTGTGCCTTCTCTCTGCGCATCCAAGAAAAGGTGCGACATGCGGTGAAGGGATCTGCACCGTCTGTTGCACTCCTTT
GCGCCCGCAGCTGATTGGCCCGCGAAAGGCCAGCGGTCACACTCCGGCACCGACTGGCTTGGCTCTCGTTGGATTCCGCTTTTGGTGGGCCACTGTCGGT
GGCAGCAGTCTTTGTCTTGCATTACAGTTTATTATGGTATTTCTATGTGACTTGTTGTTTGTATGCTAAATTGTCAAGTGGGGAGAATGTCTCAAGAGAA
AAGCCAGTTGCTCGGCTGTGGATTGGAGAGTGGCACTTCGTCGTCGCAACGTGTGTTGATTGGTTGATTCTGCTCTTACGCCCTTTCTCCCCGTCCCCTC
GCCCTAAGGAAATAGCCAGGTCGTCTTGTCCGGCCGAGGAGAGCCGCGGCCAAGTGACTGGTCCTGCGCTTACCATTGTTTTTCCTACCAGCCCGTTGGT
ACTTGACGCCCTTCTCCCTGTCTCCCCCATAGTATTTTTTCTGCTGGAGTCGGGTCAGTTAGTTTTATGGCCTCCAcgtcttcgtcctcggcCTCTGCTC
CTCCCCACGCTCACAGCAACACCATGCAGCCGCAAGATCCCGCAGCACTAGACCCAACCTTCAACTACGAGACCTACCAGCAGTACGCACACGAACGAAG
CGTACACGACCAAGCCGTGCAAAGCGCCATCGCCTCCACAACCTCCGCCAGTGTCTCCGGTGCCCAGACGTCCACCAAGCCCGCGACGTCTAACGCCACA
ATCTCCACCACGCAGCCcaagcaagagcaagcgacAACCAGCGCCTCTCGTCCCAAGATGACCACAAGCACGTCGCCTACGAGCGTCGCCAAGGACCAGT
CGTCGGCTGCTGCCCCCGCTCGCAACGAAGCCCTCAAGTCCAACCGCCTGTGCACGATGCCAGGCTGTAAGAAGCGCGTCCGCTCCAAGGGACTGTGCAA
AGCCCACGGTGGAGGTCGTCGCTGTATGGTTGATGGCTGCGAACGCAGCAGTCAAGGTCAAGGCTTGTGTATCCGCCACGGGGGAGGCAAGCGCTGCACA
CAGCCAGGCTGCACCAAGGCCTCGCAGTCCAACGGACTCTGCAAGGCCCACGGTGGCGGTCTGCGTTGCCAGAGCCCAGGATGCACCAAATCTAGTCAAG
GTGGAGGCTTCTGCCGCGCTCACGGTGGTGGTCAGCGATGTGAGAAGGAAGGATGCAACAAGGGCGCTCAGCGTGGAGGATTCTGCGCAGGCCACGGTGG
CAGTCGCTTCTGCCAGCACCCagactgcaccaagaacgACCGTGGCGGAGGTTTCTGTGCCGagcacggcggtggcaaaCGTTGCGACCACCCTGGCTGC
AACAAGCCAGCGCGCAAGAAAGGCAAATGCTCGTACCACGCTAATGCTGCCAAGGGCAAACTGCCGAAGGACCAACTTGCTACGGCCGGAGTCTCCGCGG
CTTCCATGCCCCAGCACATGATGGATATGCGACAAATTACCACACCTACGTTCGCAATGGGTGTCAAGGATCTTCGTGATCCGCACGCCGCCGGTCAGGT
GGAGCCGCAACGCGCTGCTGTATacgctcagcagcagcgagtggAAATGGACATGCGGTACAAGGGCTACGAGGCTTCGGCCAACGGCCAGTACCTGCAG
ATTCATGCCGACCAACGGTCCTACGAGCCCATTAGCCTGCAGGCTGGTGGCGCAGCTCGTCACTGCATGCCTGTTGATAGCAATTCGCTGCCCCCTGTTT
CTGGCAGCATGTACAAACCCGCACCCGCTATGGACCGTCAGGCATACGTGGCGCGTCCTACTGAGCAAATGAAGAACCCGTACACGCAGCACTGGGCGAC
CAAGTCGGagatccagcaacaacagcagcagcagcaggcacaCCCGCATGGACGTGTGGACTACTTCGAAGTGAGTAAGGAGCAGCAGGCCGCCGGCCAC
CACCTACCGTACTCGACGCAGTCGTCGCAataccaccaccacctgtCCGCTGCGGATTCGGcggccgctgccgctgctgcttacggacagcagcaagcac
ctcCACGCGGCTACTACAGCCAGCAGCATGCGCAGGCCGCCCCCTCTGGTGATCAGACTGCcccccagcagcaacagcccAACATGATGTATTACTCGGC
CAACGGGTACCCGCAGCACCAGATGCacaacctgcagcagcaacaaatgcaaaTGTTATAAGTCCAGCGAATTGAAGTGCAGTTGCTGAACGGGCTTGCT
TGATTGCACGGTGCGTTTTCTGATGACGATGGTAAACTGACCGAGTGCAAGAGCAAGGTGTCCCGCAGACGGACTGCAATGCTGTATAGCTGTTATAGAG
ATAGAAACAACCCGCTTCGGAGCGGAGCTCCTAGTAGATGGAGCGGCAAAGCAAAAGGACTCGTGCCGTCAGATTGGGACGTTCGGCCTTCCTCCCAATC
AGTTTTGATCAAGCCTGAAAAGACCTTTGAGTGAAGACAAGCAACAAATCACGTCAAATACACGTTGTTTTGGAACAGGAAAGTGTTCGGCCTGTGCTTG
GTCCTGTGTACATATacatgctgcagctggtcTTGTGTCACGACATGGATGAACCGACAGCAAGCTTGAACTGTTTCGGTGGGGTGTTTGTAGAGTCGCG
AACGTCACGCAGGAGGTGGATGTCATCGACCGAGACTCCTCTACTACTAATAGTCAGTCGGATGACGTCTTACGTCGCACTTTGACTGTAGTCGGACGGT
GTAGAGGCTCTTCGTGCAATGATCTCGgcttcctcgtcttcatctcgagTACTGCTCGGCTCCTCAGCGTGCTGCAGTGTGGCTGTAAAACTGACTGCGC
GTCTTCGAGGAACTactgctgcaggacgtcGTCTACTGGGGGGGTCTATTCTCTCCGCGTCTGCGGTGGTCGGCCCTCGTACATCTTCCAGCTTGGCGCC
ACCTTGTCTTGACTGCAATTTGGCTTGGAGATAAGTCCCAATTGCTGACGTTGGGAGATGTAGGGGGCCGGGGGACGAGACTCTTGGGGATCCTGTCTCC
TGGTTATCGTCTAGAGCCACTCGGAAGCTCCCTTTGCCAGCGTAATAGTGGCGATAACACTCGATGAGCTCGTGTTCCATCCCTTTGTACGTCTCCAGTA
GTTGTGTCGCTGAGGCTTCATTCCCCGGTTCATAGGCGTGTAGCAGTCTTTCTAACTCTGCTCTGTAGTCGGTGTATTCTCGTTGGTTGTCTCTCCACTG
ACGGTTAGGACTGGTGTTCTGTGGATGCATAACTCGTAATGTTAAgagatccagaagaagcaATAATGAGTTGTGTCTTTCAGTCTCTTCCTGGTCTCAG
TTTCCATATTCTTTTTCCACCCTTTCatgaattctatatttttTTTAGCATCTTCGTCTCAAAGACTCGGCTCTGTGACTTGCCACACATGAGAGACGAA
CGGAGCTGTGGACGAACAACTTCAAATTGGCCCAGTGTATTTTCTATCGCATTCCAGTGACGGCTACGTCACTTGCTGCTTACTTACTGGGATTGGGCTT
CGTGAAGCAGGCTTTGGAAACAGCGGAGGAGCGTGGCAATGCCTTTGCGCACACCTTCGTCGAGCTTGGGAGGAATTGGTTCAGTGACGTGAGCAAAATC
GATGAGACGGATGTCGGCGGCGTAAGGGTCTTCTTTGTCTGAGTCAGACACTTCCCCGTTATacaggaagaggaaggaaCTCGCGATAAACTCCGCTCGC
TCTTGCTCATCAAACCACGTCTTGAATTGCTCCAGGCGTCGGAGGAACTAATCAGCAGAGAAGGCCACAACCAGGGAGTTACAATAGTACTGTGAGTCAA
ACTGTCTAGGATACTAAAACACAAACCATTTACCGCCTGCAACAGTGCGATGGTCTTGGGTGTGTTGTCGGCTGGGAAGTAGTTACGGAACGCAGGTGCA
AGTGCATCTGCAGATGTGATACTGCGGCCAAAATGCTTGTCGAATTCGACGTACTCCCCCTTTTTAGGATCATACACCTTGATCCCTTGAATTCGAAAGC
CAACCTCATCTTGTAGAGGGAACTTGGACTTCTCGTACGCGATCTTCTCGGCCGTCGCGCCGTCCTCATACGATCGCGTGCCCATCTTGACGTCCATGAC
GCACGGCCACTGTCGCTGCCACGTCAGGTCCTCAAGCACCAAATACTCTACATATAAGTAAAATAATAGCAACAAACATCAATCCGCGGGCTTGTAAACT
CCATAAATGTCAACTTCGTACGCCCAGAGTGCATCCCATTGGACGTCtttgcttcttcgtctcctccgtcttggcCTTCAGGCACCACAATTGTGCCGCT
ATACGCTGGCAGTAATGCTTGTAGACCCTTAAACTCTGGTAAAGCTTTCTCCTTCACAAACACCCGTTCGTAGAACTCGTGCTCACGTTCACCACGCCTA
TTGCTCTGGAAGGGCTTCAAAATGCACCCGTCGTGGGCCTTCAGACCTGAGTAATTGACATTGATTCAGTGGTTAGAAGTCGATAGCAGTATATACAGCA
GTTAGCAATAGTCTACTTACTGGACTTGGACGCGGTATGGCCGCCCACTTGgtgctccatctccacgaAGCTGCGCAAGTCCATGATCTTTCTTCTTTGT
GATCAATACTCAGATTTGAGAATAATCTGATTCTATTATCAGAtttacaacaacaaaatTCTCGAAAATGGCTCgggtgctggtgttgggCGGGACGAGT
TACGTTGCgcagttcttgctgcagcgtttgctACAGGACAAGACGCTGCAAGTAGCAGGAGACAATAAAAATGCTATTGAAGAGATCTCAGCTGTAGCTT
GTACGATTCGCTGTCCGCCGTTCGCACCACTTCCCGATGGCTTCGTGACAGCTGAATCAGAACTGGCAGCGGAGACCAAAGCTCGCATCGTACGTGTGTA
CTGGGAAGTGGACATTGTGGATCTGGAAGCTCTACGGGCTTGCGTTACGCACTTCCGACCTACGATTGTTGTCAATTGCACAGGTAATATAATGATCTGC
GGTGTTAAGATAATATTTTGTCAATTGTGCTGACTGGTTGTGCATTCTCAGCGATATCATCGGCTGCAATATGCCAGAAGAACCCAGATAAAACACGTTC
CATCAATGAGGTATCTAACTCAATACATGGATATACCAGTGCTTTGGGATGATGCTGACGTCCAATGTATTCTGTAGCCTCGCAGCTTGGTGGGTTTGCT
GGAGACAATGCCGTGGCGAATTCGACTCGTGCACTTCTCGACGGTAAGCGATCGACAATCACAGCAATATTACCAGATAATTAACTGCTTTTACTAATGC
TCTGACTGCATTTCAGGACTTCGTGTATGATGGACTACAGCAGCGGGGCGAGAGCTACGAAGAAAATGCCGCGGTATTGTCGCCGTTACTTTCGGAATAC
GGCGCCAGCAAGGTGCGCTTTGACCAGTACCTGATCGAAAAAAAGACGGCGGCAAATTTGCAGGTAGTTATCCTCCGCATCGCGAATGTTGTTGGGCCGC
CAGCACCTTTGCTGCCAGACCACAGTGCACCCAAGTTCATGCAGTGGCTTCACCATCAACTTGCCACCAGCGACAGCACGggtgaagagcagcagacacC
CCTAGCGCTGTGGTATGACGAATACCGCTCGTACCTGTACATTCACGATTTAGTCATAGTCATGTTCAAGTTGTTGGGGATCAAATTCACGACAGGCACC
AGCCTCTTCAACGTTGGTACGTCTGGATGAAAGTGGCTCTGCTTTTACTTCATGTACTTGCCATTGACATACGATTCATTGATATTTTCAAAACCCTACA
GGTGGCGAGGAAGCACTCTCACGTGTAGATCTCGCACAGCGAtatcttgctgcttgtgtgaCCCACCATCCTAAAGCTACTGTTGTGACGAGAGAGATTG
TTCCAACCGCGCGGGCTACGATGGACATAGGGTATCCTTCACCACTCAATACGCGCCTCGACACGGCACGACTAACCCGACTATTACCAAAATTTGCATG
GACGCCGACAGACCAATTCCTGGACGAAATCAGCCGCAGCTTTCTTAGTTGAAAATGAGTGTTGACATGTTATTTGTTCAAGGAAATTATCTGTTCCTAC
TCCATGGGGCAATCAAAttgaaaaacaaaacgtTGTCGACACATACTACGTAGTAGCCAACTGATATGAAAGAAACAATCCCCATTTGCGTTCCACTCCA
TTTACTGGATCTCCATCACGTCGCCCACGCCATTATGCGCGTTTTTCAAAGCTTCGACGATCTCATTATCACCGTGGTTTTCCACATTTGTCTTCGGGGG
ATAGACAAAGTCGGCGGCACACAAAGCGATGGCATTACACGCTTCGCTAGGACTCTTGCCTGCTCGCATGAGTGACACTAACTCGTCGAACTTGGAAGAA
AGTGTGTCGCAGCGTGCACGCGGGGGAAGGATCGTGCACATGGTCTCAAGCGTCACCTTCGCCTCGCGCAGAGCCTTCTCATTGTCCTTTGCAAGCGCCA
ATAGCTCAGCAGTGTACTCGCAGAACAAACAGCCCACTGACATCGACTTCTCCACCGGGACCTCCTCCATTGCCACAGGTCCACAAGCTGCAATTCGTGT
GCAGATagcgtccacgtcctcctccttctgaAGCGAATCGATGATTGTGTCCTCGTGTTTCATCAACAACTCGCACTACAAAACAGTAAGGTTAGTCTAG
ACTTCATCAACACATTCCAACGGTCCAAGCATTATTACCTCGCTTGACTCTGGGATTAAACGGCAAACCGAATCGATCGTTCGCTTGAAAGTAGCCAAAC
TGTCTGGGTGGGTAATCAAAGacgccagaagcagcgtATTCTGTTTGCAAGTCACACACCGCGAAGGTAGGAAATCTGCGCCAGTGAAGTCCAGCACGCC
TGACTGCAGTAGTACGCTGGGCATCTCACCAGACAAGCAGAATTTCAGCGTCTTACAGATTTCTTGCGGTTCCTTCCCATCTTGTAAATCGGTCACAGCT
TCGTCAAACATCTTCAGATCATCATGGCACTGCGCAAAAAATATAATCAGCTATAATAGCAACTTGGGAAATCATGAATACCACGTACCGTGTCGTCAGC
AGGAAGTAACTGGCATACGATACCGGCAGCTTCACGCATTTGTTTCACTTGTTCTGGCTTCTGGGCAAGTGCGTACTTGAGCACAGTGACTACACCACTG
CAATAAGCGCAATTGCTGGTTCCGTTGTCGTTGTTCGGGTTCGGGGCAGCGATCTCGACAGGCGAAGGCTCCTCGAGCTTTGCCAATGATGGGTTCGAGT
CAGTTGTGCAATACTTCAAGTCGTGGCAAATAGCCTTCAGCTGTTCTCCCTTCTGCAAAGAATCAACCACAGTGTCGAACTGCTTTACGAACGAGTGACA
CTACAAGAGCACAAATAAAAGGTTAAGAATAAACGCATCTGAAGCAGGTCTGCGCGCATTTTCATACCTGGTTGTCGCTCGGAAGCACTCCGCAGACGAT
ATCAGCAATTTGTTGAATTTCAACAAGTTTACTTAGATCTTCGGCCACGGCAACCTCGATGACAGATGCCACTTGCGTGCAGAAAAAGCAGCCATCAACG
GAAATCGTCATAGAATCCTGAACCATTTGAACTAAGGTCGGGTTGTACGTTGACAGATCAGTACTTTTCGACGGTGACACAGGTGAGAGCAAAGTGTTCT
CTCCAGAGCAGTACTTCATGGACACACATATAGTGTGAGGGTGCGTTCCGTTTTTCAGAGAATCCAGTACAAAGTCCAGCTTCGCGACGTACGGGTGGCA
CCCAGACTCCTCCCCCATTAGCGCACAAGCAGTGTCTGCTAGCTCTTTGATTTGCTGGATCTTTGTCGCTTGTTGCTCGTACGCAACTTGCACGAGCGTC
GTGGCATAGTCGCAGAAGAAGCACGTTTTCGTGTTACCAGCACTGTCAGGGTGGCTCGCGACAACCAAGGCTGACACTGAATTCATCAATGGCGATTCGT
CGATGATCTCGTCAGATTTCTTCTTGCACAGATTGATACTCTTGCAAATTTCGTGCGGGCGCTTCCCTTctttctccatttccacaATCTTATCAAAGTT
CTTatccacttcatcacacTTACAATCCGGGTTAGCCAACTTGCAAATATTCGTCAAGATGGTTTTCACAACCGGTAGTTTCTCTGGTGACGTTTTGTTG
ACATGGTGAATAGCAATAGCAACTTTagagcagaagaagcacgcAGGATTGTGAGGCGGGCGCTCCTCCGAGATTGAGACAACGGCTTTTTCTTCACTGG
CGAGGACAGCAGGTTGTTCTTGCAGTCCAGCTGTGCAGAATTTCAACGACGTACAAATCGCTTTGGAGCTCATTCCCTTGGTAATCGAATCAATCACGAA
ATCGAACTGTTTCACGTAGACGTGGCACGGGTTTTCTTCGCCAAGCATATCGCAAATCATATCCGCGTACGTGCGCACTTGGCGAATATCCGCACCatat
tgctgcagcgcgatTTTAGCAACCGTAGTGGCGAATTGGCAATAAGAGCACTGGGTCGCATTGCCAGGTGGCCATTGCGAAGCGACAACCAAGCCTTTCA
GTTCCTCTGTGATCGAAGGCTGACTTTCCTCCCAGCTGTGCGTCTTGTTGCAGACACCAATAGACTTGCATATTTCATGAGGGTGTTTTCCTTCCTTTTC
CAGTTCCACAATCTTGTCGAAATTTTTGTCCACAACGTCGCACTTAAACTTCGACGGCACCAGCTGGCACACATTAGATAAAATAGTCTTCACGATCGGT
AACTTCTCAGGAGACGTGTGGTTGACATGGTGAATCACCATAGCAACGCGCGAACAGAAAAAGCAACTGCCGTGGTGCGGTGGGCACGGGTACGGGGGGT
GCGGTGGATGGCCACCACGCTGCATTATTTCCCCGTTGCCACGTTGGTTATGGTGATCCTGCCCAGGTCCCATCATGCCgacatggtgatggtggccaTG
GCGACCATTTCGCATCATGCCCACGCGTGCGCTATGATCAGAAGGAGGAGGGCCATCCATTTGTTTCGCAGAGCAGTAGCTCAGAGCCTTGCAAATATCA
CGCGGATGCACTCCCTTCTCCAACGAGTCGATCACTGTGTCCAATTTTCCAACGTATTCATGGCATGGACTGTCATCTCCCAACATGCTGCAAATCATGT
CAGCGTAGTTGCGAATTTGACCAACCTGTTCGGGGGCTTCTTGTATGATAACCTCGACAACAGTCGTAGCGGCGTCACAGTACACACATGTCTTATCATC
TCCAACCATACGCTCCGACAGCGGCGTGCCACGAGGCAGATTCATCGGCTTTTTAGTGCAAAAGTCTAGCACCCCACAAATCTCGCGTGGGTGTTGACCC
TGTTGTGCAAGCGCCACAATCTGATCGAAGTTATTTTCCACGTCCTGGCATTTGGAGTCCAGCGAAGCCATCTGGCACACACTTCCCAACACCGACTTCA
ACATCGGAAGTTGGGCAGGGAACTGGTTACTCACTTGATAAACAATTCCAGCCACACGTGAGCAGAACAAGCACGACTGGTCCTTGTCCAAGCTGTCCGA
GGTAACCAAAGCCACATCGTTGGTCTTTTCAAACAAGGCTGCATCAGCAGGCAGCAGGTTTCCTTCACTGCTATCCAACGAGCACATAGCAATCTGAGTG
CAAACCACCAATGGGTCCGTGCCGTGGTTCAGCCAGTCTACGATGGTGTCAAAGTTCTTCAAGAACGTGTGGCACATGGATTCAGCCGACATGGCGTTGC
ACAAGTCTCCGATGATAGCTCGgacctgctgcacctgctgcacttcCTGTTCCAAGGCCTGACGCACCATCTGGACGAATCTCTGGCACAATACACACGA
CAAGTCGTCGCTCCCTTCCAATTCAGCTACAGTCGTCATAATGTCAcagacttcttcatcagtTTTCCCTTCCTGCAGGAACTTCCGCACCACATCTTCC
TCGTTTAACACATGGTTACACTCTTCAATGAGCTCCGGTTGCTCCAGATCGTCACACGAGGTTTCATCGAAGAAATGCACCGACACCATCTCGAACATGG
AGCGGAAGTGTGTCATCAGcgtctcctcttcctccttgaGCTGGTCCTGTTCATGGAGTCTCTCCATAGCCTTCAGACACGCCCTCTGATGATCCAGAGC
CTTGGGattttcctcctcttcaatgACCATGATCTGCACCACGGGGACACTCTCCTGAGCCTCTCCAAAGCTGAagagacgctgcaggagctcacTGGAG
TGTTGGAACTGCTCGTTCAACACCGCCATGAGCCCAGCAGTGGCGTCAGTCTCTTCGTGGTGGCAAGGCATCTCGCCCTCGTTGTCGACCGTCTGGTGGT
GGCCCAGGCCGTGACGTACGCTGTGGTCGGCACTGGTGACGGCCGACGCGGTCGCCagacagagcagcagcgcgtgcagAGGCCGCATTCTTCGTTTCCT
TagagcttcttcttcaagctggaTCCTCTTGAACTGAGAGTCACACAGGCAGGTTTTGGCCAGAGGATGGAGGTCAGGATTATTTGATTTGTGCACATTC
CCCCATGTCACTGAGCACTTGAATATCATACAAAATATAAGGTTTTTAGTTGGTTGGAAAGACGTGCTGGACTGGTTCTACTGGAATCAGATAAGAACAA
GACATTTTGAATATATTAGATGAGTTGGAAGAAGGGATGTCATCACTAATGGAATGGCACGTGCCGCGCTCCACCATCATTCCGCaagccacttcaacgt
caacggCAAGTTCGCCAGTTCTTTCTCCATCTAACTCTAAGGAAACCTGTGTCTATCTCGATCCCTTTATTCCTACTTAACTCTCGTTGATCATCGCTGT
GAGCTCAAGGTGACCGCCTTGTGTCGATCGCGGGACCCAAAGAAGTAGAGAACCGCCACCCGTTCCGGGCAGACCCAGAAAGCCTGGACGCCAGCGATCC
AAATACAAAGTTTTCGCTCCCAAAGCCGTCACATTGGAATTCCACGTCACAATCTCCCCTGCCGGGACGGCCACTTCGTCGATCTTATTGCCGCCAGATT
TGATGTTAACACACACAACTTCTGAGTCGACACTCTGGAAGGTAATCGATACTATGCTATCACCTTCTCTTGTCCAGGTGCCGGCGCTATCGCTGAAGGC
ATCTCCAACTGTATGCAGCCCCAATGCATCTTGTGCAGACCCATCGTCGATCTCACCAATGAATTTCGTGGGACCGCAGATTGTCTGGAAGTACTCGGAG
ACGACGCCAGCGATATTTGTCAGATCCCACACTGCGTAGAACGTGAGGGCCTTGTCAGCGATCTTGTAGGCATACTGTTCAGCGGTGAAGAGTGTGCCGT
TGATACTCGTTCCTGACCTGACGAGGTCATCCAAGATGCCACTGATCGTTTTGCGTAGAGCATCGCGAGCTCTATAGGCTGCATCCTCACCAAAGTCGGC
GACCAGTTCTTCCATGCAGTTGTTCGTTATAATGGGGATCTCATTTAACACCAGATTTGACTCACTCATGGCCACGTGAATATCATCCTCTGAAATATCG
GGATCATGTCTACGGAGGTCTGCCACAGTCATCCAAGCGTGGTCAAGGAGTCGCTTCATGTTATATCCGCAAGTCGCGTTAGATTCCAGCGCAGACTTCA
GTGACGAGATATCCGCCTCATCCAGTGAATCAATGGACTCACCCAAAGTGACTTTCTTCATAAAGACTTTGAACATTGCCCAGCTGGAAACAATCTCATC
GCTGTCGGACACAATTTCCTTCACGATGAGCTCGATCGTGTTAGTTATCCGGTCCGTTGTCTTAATGCCCTCTGACACCTTCATCTCGAGGCATGTGGCT
ATTGTTATAGGTAAGTCGAAGACCACATTATCTGTCTGGTAcagcgtcatcttcagccactCTTCTGTACTGTCCGGATTGGACAATTTGATGGTACGGA
GATATTTGTTCAGTTGCTTGACCAAGTTCATCACCTCTTTGCCACACTTGTAGGCAGTTTGCACACCCTTCGCCATGAGCTTGAATTCACCGTATACTCC
AAATGTGGCGAGAGAGAATGCTGATTGGGCTACAATCGAGATTTTGGCCACGACTTCGTGTGCACAGTCGTCGTTTTGCCGGATGCATTCCACTCCACAT
TTGACGGGATACGCGAGCGGGCATTCAGCCCAGCAAGTGTGGTGTTTTGTGTGATGTTTGGTTTCGAACTCTAGGGGGCACGTCGTCGCGATATGGGCTT
CCCGGTAACATGCCGAGTCAGAGGCATCGCCCAACGAAGGACCTACCCAGTTGGTGTACGTCGACTCAATCGTGGAAATGACGGATTCATTCTTGGATCC
CGATGTCATTGCGGAAGATCCAACGTCGGCGCTGTCGAAAGACCCGTCATCGACGCTGTCGAGAGAttcctcttcttcgctgtcgaCAGAATCGTCATCA
AAGCTTCGCAACTCGGTGAAGGACGCGGCAGTTTCTGCGGCAGCACTTGTAGTAACATTGGCGATATCGGACATATTAGCTATTGGAATTGACGTTGTGG
TATCGTTGAACGTGTACATTTGCGCCGGGGTAGTAGACGTAATGGCCGTGGTCAGTAAAGCAGGAACCCAGAGCAATCGAGCCATCGTGGT