Description :
From Genome Similarity Track
Location :
Scaffold_3514:1342- 2522
Sequence
1180 bases(100 bases per row)
CCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTCCGATTCGTACGATCCCGCAAGAAATCATAGAATAATGCTCCACCGCTCAGATCTG
CCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCGTGTTGGT
GATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCTAACTATCTTCCGGTAGGAGGACTTCGTCGAAATCCACCCGGTCGGATTCATCCACC
GAAAGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACCACGGGGAACAAGCGATATTCGGTACCTGCCGTTTCCAACT
TCACGGCGTGTTCCCCTATCTTTCACTTACTCTGAACGATCCAAGCCAAAGATGGGCCAGTTTACGGGAATATCCTTCTTTCACTCGATCTAGGTACAGC
CATACCTGCGATTCAACGTGGATTTGATGTGGACGGGCGTCTTCGTTGTATCGATCCGCTCGATCTTGTATCGCACTCCGCAGCCGTTCGTTCACTTGGG
ATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATTGTCTTGGATCTCGATTTCTCTTCTTGGTGCTACATACCGGAATGGCCGCTTCTAGGGT
GGATTTAGGATCCCACCCATGTATTAAGTAAGATGGAGTGTCACCCCAGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGGGGTCGTTCTGCGTACTC
ATCCCAATCCCTCTGATCCAAATCCTGGACATACATCTTGAGTGCCCTCGTGATCGTCTGTACCATGCGCTCGGCCGATACGTTAGCTTGGGAACAATAT
GCCATGGTTGCCCGCTGTCTCTGCCCCAGGATCCGGTTGAAAGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCTGATCATGCCTAATCATCTCACTAG
CCCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCGGCAATGGTTGTGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGGTAGCAGATTC
ACCCAGATCAATAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGGATGGTGATCCATGGCTATTGATTTGAAA