Description :
From Genome Similarity Track
Location :
Scaffold_17:13418- 15154
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_17-fgenesh-gene-0.2Proton-dependent Oligopeptide Transporter (POT) Family

Sequence
1736 bases(100 bases per row)
ACTTCAAGAACGTGCTGCTCCACGTGTGCTCGTTCATTCTGATACTGGAGTTCGCCGAGCGCGTGAGCTACTACGGCATTAACCAGGGGCTCAAGAATTA
CATGGGGCGCATCGGATGGTCCCAGGTCGGATCCAACTCGCTCAAGTCGACGTGGACTTCGATCTGCTATCTGTCGCCGCTGCTGGGCGGCTACATTGCC
GACGAGAAATGGGGCCGGTTCCGCACGCTGTGGGTGTTTGGTGTGTGGTACACCATCGGCGCGTTCCTGCTCGCGGCGTCGGCGCACCCGGATCTCATGG
AGAACCATAAGCTGGCCTCGAACTTTATCTGCCACATTGGCCTCTTCGGCTTCGTCGCCATCGGCACGGGCGCGATCAAGGCCAACGTGATCACATTTGG
CGCCGACCAGTTTGACCCGAACGATCCGAACGAAGTCACGCAGAAGGAGAAGTTTTTCAGCTACTTTTACATCGTCATCAACCTCGGCGCGATCTTCTCG
TACGGCTACCTCTCGGTGCTTTGTGTCGAAGGCTCCGGACTGATTCCTGCGAGGTACGGCTACTTTGCCAACTTTGTGATCACCGGCGGCATCATGGTGT
TTGCGTACGCGCTCTTCTTTATCGGCACACCGCGGTTCGTGCATTTCCCGCCGCAGGACAGCGCACTGACCAAGCTGTGGTCGATCGTCAAGGGAAACTG
CGCGTACAGCTACGAGGCACGGATGCTGTACTACGGACTCATTGCCTTTGGCATTACGTTTCCCATCAATCTGCTGGCGGCGTTTCTCGCCGATGCCTCG
AGCGCCGGTCAATTCCTCTCGTACGTTGTCGTTGTGCTGTGCCTACTGGGCATGTACGCGTGGATTCGGTATGGTATGAACACGGCGTACATGGACAAGT
CGAAGGCCTCGAACGGCGGGCGCTACAATGACGAGACCGTGGACGAGATCAAGATGGTACTTCGCGTGCTGCCGTTTGCGTCGTTCATGATCATGTGGGA
ATGTGCCTACGATCAACTGGACGCCAATTTCCAGTCCATCGCGCAGCAGTGCGATCTGCGCCTTGGGACCACCAATTCGACGGACTACGACGCACCGCAA
ATCCCCGGCGCGAGCCTTGGCATTTTCGACCCGCTCACGATCATCGTGCTGATTCCCGTGCTCGACAACTTTGTCTATCCATTCTACGCTCGCATCATGG
GGCGCCCGCCAAGCGCCTACGGCAAAGTGCTTACTGGGCTGATCGTTGCTGCCCTCACAATGTTTTGGGCGGGAGCCTTTGAAGTCATTCGACGCAACTC
TCCGCCGCTGATGTTCTACAACTACACGGCTCAAGAGTATCAACCCATCACTGACAACGGGTCGCTGCAACCGATGAACAACATTTCGTGGGGGTACGCC
GTGCCCATGTATATCCTGATCGCCGTCGCCGAGTGTCTCATCAATGTCACCGCCTACGAGCTATTCTACAACGAAGTTCCGATCTACCTCAAGAGCACGT
GCCAAGCGATCAACCTCTTCATGGTTGCCATGGGTAGCAACTTGACGTCAACGTTCACGCTGATATTCCAGAACTACATCGGCAGCAACTCACTGAACTA
CAAGCACTCCACGATACCGTACAAGGACTCGCTCAACCACGGCCACTTCGAGTACATGTACTACACGCTGGGCGCCCTGAGTATCGTGAATATCGTTGGC
TACGTGATCGTGATGCAGTGGATGGAGTTTGGCATG