Description :
From Genome Similarity Track
Location :
Scaffold_398:13418- 14862
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_398-snap-gene-0.2760S ribosomal protein L6

Sequence
1444 bases(100 bases per row)
AAACAACACCAACTTTAAAAGTTCAGCAGGTATTATCGTTTAGATTAAGCTCGCATCACGCTGGTTATGCAACACTTAGAACTTGAGCGCGTGGGCGCGG
TCGTTCTTGGTCAACGAGAACTTGGCGTTCAAGTACGCCTTGAGGAATGGCTCCGCGTCGATCTTCTTGATCAAGGCGGCGTCCACGGCCTTCTGGTCCT
TCTTGCGCTGGTCTGGGATGACTGGGGCCTGAAAGGAGTCATACAGAACGATGGGTTAATGCCTTGTGCGGTAGGGAGCTTTTGTCACGGCAGCGATCCC
AAGCGCTGATAAGTGAAGCGACAATGTCTCCCAGAAGAAGACAAAGTCAAACTTCGTATACCTTCCCACAGAGACCACGTGTGGTGATCTCAATGGTGCG
GGTATGGTGTGTTCAGTGACAAAGGGGACCGGTTGTATGCCATCTAAAGCAATTAACAAAATAGAAATAACAACTTACAGCAGCAGACTGAGCGAAGAAT
TGCTCCTCCTTGGTCTTCTTCGACGACACCTTCTCCTTGGCGAAGTACGCGTCGTTGATCTCTGGGAGCGACACACCCTCAAGGTCGACCTTGGTCGACG
TGGCGATCACGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTTCACGCGACGAAGTGGGACACCGTTCACCTTGTATGGACCTATGACAACAAAGCA
AATGTCAGTAAATACTGGACTTGATACAGATACCATGTCGTAGCACACGTCCGCCGCGCAGTGAAGCTGAAGCTCCATGTTCCTCAGCTCTCATAATCTT
AACAATTCTTCGGCAGATAAGACCAACAACCAAACCAGCACTTCTCCCATAAATGGGAAAAGCGCCGACTAGGGCTCTTAACCATCTCCTTCCTCTCCAG
CAGTCAGCACTACAAGCGAGTGAACCCGCATACAGTGCATCGTCCCACCAGAAAAGAAAAAAACAGCCTCAAGCAGAGTCCTGTCTCGATTGCCTCTCGA
CGTAAGTTTGCATCATTGGAACTCGACAAAGACGCTGCTGGCGGACCTGTGCTGCTACTGCTGTGTGTCGGCACGCTGACGTACCAGTGACAAGGAGGAG
ACCCGATTCGAGCTGCTTCAAGAACACAACGCGCTTGCCACGGAAACGACCCGAAAGGAGGATCAACACCGAACCAGGCACGATCGACTTGCGGAGCTTG
GCGGTCTTGACCGAGTTGCGGGCGGTCTTGGCCGATGGCAATGGCTTTGGGATGTAGTCAGCTGGGTACCACTTCTTGGTGGACACCTTCTTGGCAGCGA
CAACCTTCTTCTCACCACCCTTCTTGGCGAACTTGAAGCGGCCGTTCGTCTTGCTCAACGAGTTGCGGCTGATGGCATTGATGCCACGCGCAAGCACGAT
GTTCTGGCGCTTGGTGGAGGTCTTGGCGGCGGCTTTAGCTGGCA