Description :
From Genome Similarity Track
Location :
Scaffold_319:13411- 20315
Transcript NameFunction/comments
Phypl_g6915glycosyltransferase

Sequence
6904 bases(100 bases per row)
CCTTCCTCCCTCCCGCACTGACCCGCACTGGGCTTCACAACCAAACAGGCGTTGGCACTTCGAGTGCGGAACCGCATCGAGCGcttgaccatcactcttg
cAGCCTTCCGCACTAGCAAAGGCAACGGCACCGGCACCGGCACcggcacgagcaggacgatggccacgacgcccgGCGGCAAGATGGACCGGCGCCGCGC
CGGCTCCAACTACTTCCAGCTGGACGCGGACCGCAAGCGCAACACGTCCAACAACCGCAGCAACTACGGCGACGGCCGCGGCACGTTCGGCGACCGCCTC
AGCAtgatggaggtgctgccCCCCGCGACGCAGGGCGGCCACCAGatgcgcggcggcggcctgcagGGCGACTTCGCGGACGAGATGTCCGTGGACTTCT
GCTGCGAGGTGCTGTACAACAAGTTCGGCTTCCAGTCTGGCAGCGTGGACAACCAGcgcgagcacgtgctgctgctgctggccaacgccAAGGCGCGCGC
CAAGCCGCAGGACCCGCCcggccaccacgtcgtgACGCTGcacaagaagctcatgagCAACTACACCGAGTGGTGCCAATTCATCGGCGCCCCCAGCGTC
TCGTACTCGGGCCAGCCGCAGGGTGACCTCAAGAACCCGCTGCACATGGACATCatgctcttcctgctgctctgggGCGAGGCCGGCAACCTGCGCCACA
TGCCCGAGTGCCTGTGCTACCTGTACCACCAGTCGCTCACCATGCTCAACCAGGACttcctcggccagcagaaGGCGCCCGAGGGCTGGTACCTCAGGCA
GGTCGTGCGCCCCATCTGGAAGGAGGCCTCCAACATGCAGAGGAAGAACAGCCTGGGCAAGAACCTCGAGCACACCCAGGTGCGCAACTACGACGACATC
AACGAGTACTTCTGGAAGAAGTACTGCCTCAAGGTGGACATCACGCACATTGGCGAGGAGCTGACCAAGAAACACACCAAGACGTACTATGAGCAccgca
gcatcttcacgctcgtgctcaacTACTACCGCATCTTCCAGTTCAACATGATGTTCATGATGTCTCTCATGGCCCTCGGCTTCATCTCGGCCATCTCCCC
CAGTGGCGGGCAGCAGTGGTTCGCCCAGTTCGAATCTCTGGGCGAAGTCGTGGAGCCCTACCAGAAGCAGGACGTCAAGCTCACGTACGTGGGCATTGTG
TTCGCTCTGTCGTCCATGGGATTCTGTAAGAcggtgctggaagcgtgcCACGGCTGGCACCTGCTGGTTGCCAGCGAGTCGTCCgagacgtcgtcgcgct
cgttCAACTACGGTGGCGCTCTCGTGCTTCGGATGCTCTGGAACGGCGCCTTTGCTGGCATCTTTGGCTTGATGATCTACACCCCGCTGATCACGAGCAA
CAACACCCAGCTGCTCGACAAGGCTGCCACGGCGTCAATTGCTTACGTTCTTCCTGGTGCCTTGATCATCATCGTTCAGGCATTTTCCCCGTCGATGATT
ACCAAGTCGTTCGCGGCCAAGTTCATCCGCGAGGGCGAGTCTTGCTACGTCGGCCGTAACATGGCGCCTCCGCTAAGCTACCAGATGAAGTACATCACCT
TCTGGTTGGTGCTGTGGGCGCTGAAGGCGTTCGTGTCGTACTTCATTCTGGTGCGCCCGCTGGTTCTTCCGTCGCTTGCCATCTATGAAATGGAGCTGGA
GTACGGTAGCAACGTCGTGTCGTTCCACAACTTCGGTGTCATTGCTGCGCTGTGGTTGCCAGTGATTTTCATCTTCAATTATGACACCCAGATCTACTTC
ACAATTTTCCAGGCCACCCTCGGTGGCATCCAGGGTCTGATCATGAAGACGGGTGAGATTCACGGCATTAAGGAGATTACGAAGGCTTTCCGTGTAGCAC
CTCAGCTTTTCGACCAAAAGGTGGTGACCAACCTCGCTCGCTCCAACGACGCGGCCGCAGATGGATCTGCCGCTGCGTACCAGTCGCAGATGATGCTGCG
TTTCGTGGTCGTCTGGAATGAGATCGTGAACTCATTCCGCGAGGGCGATCTGGTGGACGACAAGGAAGCAGCCATCCTGCAGTACGACATCCAGAGCTCG
ggcgacgtgttcgagcCTGTTTTCCTGTCAGCTGGTAAGCTggtggaagcgctcgacTACACGGTGAAGCTTGCGAAGGAAGGTAAGGGCGACTCGCAGC
TTCAGGTGTACATGGTCCAAAAGGATTGCCTGTCGGCTGTGCGTAGCTTCTTCACGGCCAGCATGTACGTGATGGAGGCTCTGCTGGGCAGTGACGATGC
GGACATTCTTGATGCGCTGCGCCAAATGGAGACGATTGCTGCTAACGGAAGCTTTATGAGTAcgttcgacgccaagagcCTGGTGCAACTGCGTACTGTG
TCGATGGAGTTCCTGGAGGCTGTAATGGACCTCCCAGACCCGGATGCTCAGTCCTCGCACATGACGACGTCTCGTGTGCACACCATGGGTGTTGTGCGAA
ACTTCGTGACCAAGATGGAGAACCTGCTCAACTCTATTCGAATCTTCGCGAACCGTCCTGAGCTCGCTGCCAAGTTCAGCAACTCTAAGttctgctcgag
cgccaACGGCTACGTGTTTGCCGCTCGTGGCCTGGTGAACCTATTCCACAACGATACTGCCATGGGTGCTGCTACCCGCGCATACCTGCTGATGTCTCTT
GAGAAGGCAGATGCTATGCCGCGCGTTCCTGAggctcagcgtcgtcttggttTCTTCATGAAGTCGCTTCTGATGGACATCCCGCAGCTGACGTCAGTGA
AGGAGATGCACTCGTTTTCGGTCGTGACCCCGTTCTACAGTGAAAGTGTGTTGATCTCTCTAGCAGAGCTGAACGATCCGCTGGTGAACCACCCTGTCTT
TAAAAgggtggaggagaagggcAAAAACATTACCATTCTGAAATACCTGATCACGATCCACCCGGAGGAGTGGGAGAACTTCTTGGAGCGCATTGATGTG
AGCACTGCGGAGGAAGCGCAGGCGAACTACCCGCTGGAAATTCGGCTGTGGGCCTCGTACCGTGGTCAGACGCTGGCGCGTACTGTTCAGGGTATGATGC
TGTATGAGGATGCCATCAAGATTCTGCACTGGCTGGAAATTGGTTCCAGCCCTGGCAAGACTGCTGAGCAGAAGCAGGCTCAGCTTGAGGACATGGTGCG
CCTGAAATTCTCGTACATTTGTGCTTGTCAGGTGTACGGTAAGCATCGCGCTGAGAACAAGCCTCAGGCAGATGATATCGACTATCTTCTGAAGACATAC
CCGAATTTGCGTGTGGCCTACGTCGATACCATTGCGTCTGATGGTGGCAAGCAGTACGACACTGTGCTGATCAAGAGCGAGGGCAACGAGATTGCCGAGG
TGTACCGCTACGAGCTGCCTGGCGATCCGATTCTTGGTGAGGGTAAGCCCGAAAACCAGAACAATGCGCTTCCGTTCACGCGTGGCGAATACCTTCAGAC
TATTGATatgaaccagcagcactaCTTCGAGGAATGTCTGAAGATGCCGCAGCTTCTAGTGACTGCTGATCTGCACCCGTCGAAGAAGCCTGTTTCGATT
ATTGGTATGCGTGAGCACATTTTCACGGGAAACGCTTCGTCGCTTTCGAAGTTCAAGTCATGGCAGGAGCTGGTGTTCGTGACGCTGTCCCAGCGTGTGC
TGGCTGACCCGTTGTGCGTCCGCATGCACTACGGTCACCCTGATATTTTCGACAAGGTCATTGCAAtgcctcgtggtggtgtGTCCAAGGCTTCAAAGGG
CATTAATTTGTCTGAGGATGTGTTCGCTGGTTTCAACTCAACCCTTCGTGGCGGTGTGGTAACTCACGTGGAGTTCATGCAGTGTGGTAAGGGTCGTGAT
GTGGCTCTTTCGCAGATTTCGATGTTCGAGGGTAAGCTGGCTAACGGTGCCGGTGAGACGTCTCTCGCTCGTGAGGCTCACCGTATGGGCCAGTTCATGG
ACTTCTTCCGTCTGAACTCGATGTACTACTCACACACGGGTTTCTACTTCGCTACGTGGATGACTATTGTGACGACCttcgtgtacatgtactgcaaGGT
GTACCTGGCTCTGGCtggtgtgcagcagcagattgTGTACGACATGAACTCGACCGCTGTGATTACCGACAACATTGCCAACAACTTCGATGAGCGTGTG
TTTACGGACCTGAAGGCTGTCCTCAACACTCAGTTCTACATCCAAGCTGGTACTTTCCTGATGCTCCCGCTGATGTGTGTGTACTTCGGTGAAGGCGGTC
TGGTGCGTGGTATGACGCGATTCATCGATATGATCATCACGCTTGGTCCGGCTTTCTTCGTGTTCCAGGTCGGCACTACGATGCACTACTTCGATAACAA
CATTGTGCACGGTGGTGCCAAATACCAGGCTACCGGCCGTGGTTTCAAGATTTCTCGAGAGACGTTAGTGCTGCTGTACAAGGCATACGCAAGCTCACAC
TACCGAAAGGCTTGGGAGCTGATCGGTTTGTGTCTTGTGTACCTGACCTTCGGTAACTTCTACATCTGTCAGACCGATGCGTCCGCCAATGACAACACCT
TCGCGTCAGACTACTGTGACACTTCTCAGGCTTACGGTGTGCAGACGTTCTCGGTGTGGTTCATTTCCATTCTGTGGGTGGTCGGTCCGTTCATGTTCAA
CAGTGATGGTCTTGACTTCAGGAAAACGAAGGTGGACGTCCAGCAGTGGTGCTTGTGGATGTTCGCTCCGGAAgactacagcgacgacgatccGGCGAAC
AAGGGTGGCTGGGTTGGCTGGTGGAAGGGTGATCTGGAACAGCTTCACGGCTCGAACATGATCTCCCGTGTCACCGTGATTCTTCGCGAGTGCCGCCACT
TCCTGCTGATGTTCTATGTGGCTACGCTTGAAACATCCGACGTCATGTACGTTGCGTACTCGTTTGGCGCTGCCGTTGCGACGATCATTCTCCTGGGTGT
GTTCCACGGTATTGGTATGGGCATGCGCTCCATGAGCCCGGTGACTCGCGCGGTGATCTACTTAGGTAGCATGTCTATCTTGGTGACGGCGTACTTCCTC
GCTACGTGGATCGTGATGGACTGGACATTCAAATACTCCATCTCACTCTTCTTCGCGTATGTCGCTGCGCTGTACGGTATTAACGAGTGCTTCCGTATGT
GGAGCTTCCCGCACTCGTCCATTGCCGGTATCCCCgtgttccagcagctgcagttcctgtttgacttcatcttctgcaCGGGTATGATTATCccgctggt
ggtgatgtCGTGCATTCCGTTCTTGAACATCATTCAAACGCGTATGATGTACAACGAAGGCTTCTCAAAAGTCATGTCCGCTTCTTCGCAATACGCGTTC
TCGCTTGCTGCCTTCATGGGCGTTTTGGGTGGCATCGGTATTGGCTGGCTGTTCAACCTCCTATCGACGCTGGAACAGTCGGCAAGTTTCGCGAGTTACG
TTGTGACTTACGATGGAGTGCTGAGTGGCAATGTCGGCGATGGTACGACCACATTCATGCTCTACGGAGCGTGTGTCGTGGGCACGATTATCGCTGGCTT
CCTCAACTACTTCCTTGGACGCCGTCTGTCCATCGTTTCCGGCGGGCTCTTTAGCACGCTAGGTATGGTGGCAGTCAGTGCCAATGACGCTCTCCGTTCG
ACTCTTCTGATGCCCGGTATCGGTCTGCTCGGCGCCTCGTGTGGTATTTTGCTGCCATCTTTGGCCATTTACATCTACGAGATCTCGACCAAGGAGATGC
GTGGTAAAGCtatcctgctgctgggcatgggCTTCATCGCTGGTAGTTTGCTTGGTGGCGTTTTCGCGACTGTAAACCAGTTGGGATGGATCTGGCAGAC
GTTTGCTGCCTGCATCGTCATCGCACTGGTCACTCCGGTTGTGAACGTGTTCCCCGAAAGTCCATACTgggtgctggagcgcaagggCTGGGATGCTTGC
GAAGCCTGCCTCGTTGTTCTGCGCCGCAAGCCCGATGTGCAGGATGAACTCAAGATCATGCGTGAGGAGGAGACTGCTGACGAgggtggcgctggcgctt
tCAAATTTTTGATCGGTTTGTTCCTCATGCTTGTGTCGTCGCTGACGACTGGTTTCCTGAACGCCTTCATTAGCTACAAGGGAGCCAGTGAGTACACAGA
CCAGGACCAGTTGTTCGTGAACGCCATGGCGTTGCAGATTTCGGGTGCTGTCATCGCGTTCTTCTTTATCGACAAGCTGGACCACAAGTCCATTTTGTTC
GGTACCCTCATTCCCGTTGCCATTTGTGCTGGTATTCTCGGCTTTaacgagtcgtcgtcgctcctGGGCAACAGTGAGGGCTCTGGCCTGTATGTGAGTC
TGGTCGTCATGCTCATGTACTTCTTCATGGGCCTGGGTACGAGCTCTGCGCCGTGGTCAGCCTGTGTGGGCATGTTCTCTACGCGCGGCCGCGCCTCGTC
AACGACCATGCTGTTTGCCATCTTCTACTTGGCAGACCTGGGATACGTGTACATGCACACACACGACTCGATGGTTGCGAACGAGTatctgtacatgtac
gctATCGCAGGTTTCAGTGTCGTCGcactggtgctgctgttgggcGCAGGCACCCGGAAGAACGGTGTCATCTGTACCAAGACTGAAGCTCAGCGTGACC
GCGATCGTATTGCGCGCATGCGAGCCGAGCGCGCAAGCCGCAACACGCGGACTCCTGGTACTGCTCGCCAGCGGAACTTGAGCCGCGTGCGGTCCAAGTC
CAACGCAGGCGGCCAGCGGGGCAACGCTACGCCTGGCAACTACCAGATGTACGAAACACCCGCCAACGCCGCGCCACCGCTCATGCACGCGCGCGCTTAG
AGGG