Description :
From Genome Similarity Track
Location :
Scaffold_1063:1341- 3790
Transcript NameFunction/comments
Phyta_totarag11906hypothetical protein

Sequence
2449 bases(100 bases per row)
CGCCGGTGATCACGCGAGAGGGGACGCAGAAGACAAACACGTGTGCGTTAATGAAGGAGGTGAGCATTATGCAGCAGATCTCGAAGGACACATGGCGGTA
TTACCGGAGATCACATCGACGACAGAAGAAGTCAGGATCGAAGATACCCAAGTAGGAAATCCTGAGGAGAATACGCCAGAAGAGATCGAGCGACTAGTGA
AGATCCTATGGCACCGCCGACACCTTCTATTTGGGAAAGGAAACGCCGTGCCGTCGGCTGCGGAGTGAGCGATCTGCGACATTGATGTGGGAAATGCAAA
ACCAATAGCCCAACGGGTCCGCAAAGTTGCTCCACAGTTCCACGAGAAGTGGTTCCAGCTGATCAAGGGATTGCTGTCAACCGTGATCATCCGGCACTCG
ACGTCACCATGGGCGTCTCCTATCGTCGTGATCATCAATATGAACTGAGTTGATATCAGACTCTGTATCGACTACCGCCTGATCAACAGTCTGACTCGAC
TGATGGCGTATCCTATGTCGCTTATCAGCGACCTCCTCGACGTTCTTGACAAGATCCTCTTGTATTGATCGTTAGGCATGACTATTGGATTTTGGGTGGT
CTCTATGACTGATCGAGCGCGTGTGATCTCGGCGTTTATATCTCCGTTCGGGCTGTTCGAATGGAATCGAATGTCATTCGGACTGGAACCCGCGCCACAG
ATTTACCAAAGCCTGGTGGACAACGCGCTGTATGGGTTTCTCAAGATCATGAGCAACCAAGATCACGCCAACCAGACCGACGTATTTGAGGAGGGAGAGC
CTGACGTAGAAAAGGAATCGTCGGTTCTAGGTCGTCGATCTTACATCGATGACATCCTTGTGACGGCAGATTCGTGGGATACGTTGTGTGAAAAGGTaga
gaaggtgctggacgcctgTGACGAGTGGAATTTATCAATCAGTGTTGCCAAGAACTTCTGGGGTCTACGCAAGGTCGACTACCTGGGCCACCAAGTGTTT
GCTGGCGGACTGGAAGCTCGCCCGAAGGACCTGTTGCCATGCCATTTCCGACTACGATATgatcgatgcagtcgttTTTGGGGAGTCTCAACTATTACGT
CGCTTCATTGAGGACTTCGCGATATAGGCGTCGGTCCTGTACGAGCTCCGAGAGGCCAATTTATATGAGATGGCGCGAAGAGCGAAACTGGACCTGGCAT
CCAGGCTAGTCGAGAACGAACCACAGATGACGATGACAAGTGGAGTCGAGCTGTCACGGCCGCCACCGTACTGAAGGATAAAATCGCGACAACGCCAATC
CTGTAGTATTTCGATCCAGATCAAAGACCGGTGGTGGTAGTAAATACAAACAAGTGGGCGATTGCGGTCGCGTTGATGCAAGAACATGGGGTATATATAA
ACCAGTGACGTTTACCAGCCGTACGCTCAAGCCTAACGAGATCAACGATGGAATTGTCGACAGGGAtgttctcgcgctgctcagAATCTTAGATGTCTGC
TACACGCAGTTGGTGACGAGATTGGTCAAGGTGCTGACCCGACACTCCCCGTTGGCATGGCTATTGCGCTAATCAGGATTGTATGGACGACTCGGTCGCT
AGGCCGCGTAGCTGTCGAGCTGGTCCGTGGAGATCGTCAAGTGCGACAagggcgaggacgagattTTAGGCGTAATGTCCGCGAGCATCACACCGCGTGA
AGAGGTCGACGCGATCTTGGTATCGATAGCTCCGACGAAGCAACCCCGACAGGTAATCATCATGCCGCCACGTAcagtggaggaggaggagaggaTGTTA
GTGGTCAACTTCGATGGATCGGCTCGAGTAAaacgaagtggaggagcGTACAGCGCAATTGTATGGAGTCTACCAGAATGGAAAGTGATATCAACTGCGT
TGCAGTACAAAGACGATGCGACGGTCAATGAGGCAGAATACCACAGTTTGCTGCTATGTTTCGATCTTCTGGCCGAACTGGACAGAGGACGGCTAATTTT
TTATCTGCGGAGATTCGAATTTAGTCATCGGACAGATGCGAGTTGAGATCGATTGCAAGGCGCCAGAGTTGAAATTACTGCGACAACAGGCTATGGAGCG
CCTGAGATCGTGGCCAAGTCACGAATTCCTTCATATGAAGCGAGATTGGAACCAACGCCCAGATCGACTTGCTGGTGCCGCTTTCCTCTTCAGCGTGAAG
GCGGCACGATAGTGGCGTCGGAAGATGAGTTCCAAGACTTGATAACGCTAAATCATCTCGACGAGATGCTAGTTTCACGATCTGACAGCTCCACGATCAA
GATCACGGCCTTGACTAGATCGCGCAAGCGACGCAGTCTGAAGTACTACAGGAGGAGATTGTTCAACGAATGAGGGAAGAGCGCATTTGCCTGGCTCAAG
ACGAAGAGAAGTGGATCGTCGATCTCAAGCAGTATTTGCATGAGGACGT