Description :
From Genome Similarity Track
Location :
contig_19:134023- 135575
Sequence
1552 bases(100 bases per row)
TGTGCTGCACCATCATGGAACTCAGATAAAACTTGCGTTCGAAGCTCATAGTCATGTGGTACACAGATAGCGTCCACATTACCTTCCATTTGGCGATACA
CAATGTCATCTTTCCGATAAAACAACCCACCTTCCATACTTCGAGGTGCATTGTCTAGAATCGGGCTGAAGTCTGCATCTGTACGATACCCAGCAATGAA
GCGCGAGCGCATTTGTCCGGATAGCGCAATCGCTGTAGCATACCGTGTAGTAGCGTGGACCTGAACCGCAACCTGTTCTTGAGGTACAACAGGACTCCTG
CGGTCAACACTCACCCCTCGTGATTGATCATCTAGGAGAAGATGCAAGTCATACGAGTTGCGAGAGACAAGCGCGTTCATACCCGTTGGTGATCATCAAT
TCGTTTTTGGGCATGACTGCATGCCTCAGAACATGTGTGTATATCGACAGTGCTCACTTGCACAGCATGATCATCGCTAGTCCCCTGTACTTCATCTTCG
ACAGGTTCATCACTAATCTGCTCGTCCAATTTTGCCTGCATGTCTTCAGGGTCACCTGGAAGGTGGCGCGACAAAGCATCGGCAACGATATTTTGAACAC
CTTTCACATGATGGAGTTGAAAATCGAACTGTGCGAAAAAGTCGAGCCACCGTGCCAATTTAGATGACACTGTCGGGTGGTTCAGGAACCATCGGCATGC
AATATTGTCTGTATACACGTGAAAATGACGCCCATGCAAATAGTGGCGCCACTTGCCAAGTGCAAGCTTTATCGCGAACAGTTCTTTTTCGTGAGCTGGC
CAATTCAACTCGTGATTGCCCAATTTCTTGGAGTAGAAGGCGACAGGGTGGTCAAAACCGTCGTGCCGCTGAGATAGAACGCCCCCACAGCACTGCTTAG
ACGCATCGGTTGTCACAACGAACATCACGTTGAAATCCGGCAAGCGGAGAATCGGAGCTTGCTGTAGTGCTGCCTTAATTACCAAGAAGGCATTTTCTTG
ATACGGAGTCCACTGCCACGTTTTGTCTTTCTTAACGAGATTGCTCAGTTAAAACGATGTCAGCAAACCGATGAATGAAGCGTCGGTAATAGCCAGCAAG
TCCAAGAAAACTCTGCAGTTCCTTTACCGTAGTTGGCGTTTTCCACTGCTCGATAGCTGCAGTCTTCAGCTTATCGACCTCCAACCCTGCACTTGAGATT
GTGTGTCCCAAAAAGTTGACGGATGTCCGCGCAAATGAGCACTTCTCAAGGCGGGCGAAAAGCTTTTCGCGGCGCAGGATATCAAAAACCGTCCGAAGGT
GCTGTGCGTGTTCGTCCATCGACTTGGAGTACACGCAGATGTCATCGAGGTAAACGACTACGTAGTCCAACTTGCCTAATAGTAGCCTCATTAGTCGAGA
CCAAATGCCTGGCATGCCAGCAACACCCATAGGTGCGACGCACCAGTGATAAATCTCGTTTCTAGTCCGAAAAGCTGTGTAAGGACGACTTGACCTCTTT
ACTCGCATCTGATGGTAGCCTTGGGCAAAGTCAATCACACTGAAAATCACTG