Description :
From Genome Similarity Track
Location :
Scaffold_129:134020- 135477
Transcript NameFunction/comments
g12528.t1hypothetical protein

Sequence
1457 bases(100 bases per row)
CCGGAGCTGCCCTTCAGCGACAGTCCGGGATCCTAGTGGACGAGGAAAACTATCCAGATTTGGTGACCCTAAACCGGTTGGACGAGATTCTAACCGTGCA
GTCCGAGGAAGCCGTGGTCCGGATCTCGCCAGTGACCACCCGATCTGGAGTCAGATCCGGATCTAGTCCGAAGGTAATACATGAAGAATTGGTGAGGGAA
CTCAGGATAGAGCGAATTCGTCGGGCCCAAGATGAAGAGTCTTGGATCGCCGGAATGAAGAAGTATCTGGCTGGCGATGTAGCTACTTTGACCCAGGAAG
AAGCTCGATCCTACAGCAATCTGGCAATGGATTACGAGATGGATCTGGACGGATTACTCTTCTACTGTCCACCAAACCGGAAGTCTGACGAAGATCGAGA
TCTCGCGATGCGGTTGATTGCACCCGAAACTCTCCATCAGGATATCCTGCACCACTACCATGCTAGTGTAGAGGGAGGCCACCAAGGGATCGGCCGCACT
TACCAGCGGATCCGAGATCACTTCCACTGGAGAGGCCTGTACCGGAGTGTCCAACGGTATGTTGGGGAATGTGTAGACTGCGAGACCGGAAAAGGTCGGC
CCGCGAGTCACCAGGGAATATCCAGGCGACCTATCCGTTCCAGATCATAGCCATGGATCACATACCTTCGCTGCCGAAATCGAATAGAGGCAACACGGAG
TTGCTGATCTGGGTTGATCTGTTCACTGGCTATGTGATGGGCAAGGCCAGCTCATCCAGGACGGCTCAAACGATAGCGGAATCCTACGAAGAATGTGTGT
TCCGCCGATTTGGCGCAAGCGAGGTAATTCGGCACGATCGGGAACCAGGATTTATGTCTGACTTCTTCCGAGCGTTCAACAAGATCCTAGGACAGCGTCA
GAGGGCCACTATGGCTTACCGACTGCAAGCGAATGGGACGGCGGAGCGCATGGTTCAAACGATCACACGCGCACTCAAGATGCATGTCCAGGATCTGGAT
CAACAGGATAGGGACGAGTACGCCGAGCGGCTTACGTTTGCCCTTAACACAGCCCAAGATCGGATCCGAGGTGATACGCCTTTCTATTTGGTACATGGGT
GGGATCCTAGGTCTACATTAGAGGCCACGATCCCGGTGGGTAGTACTCGACGTCAAGATCGTGATCCACGCCGATGGCGCTACCGGATCCAGCGTTATTA
TACGCGGGTCCGAGAACAAGTCAACGAAAAGCTCCGTGAGGCGATTGCAGATCGAGCAGATTCGCACAATGACGATGTCCGACCCCACCCGATAGAAGCT
GGATCTCGTGTCTGGCTATACCTGGATCGCGTGAAAGAAGGTTACGCCCGTAAGTTGGCGCACTTGTGGCACGGGCCATTTCGAGTGGCAGAGAAAATCC
ATGAGTACGCGGTCAAGCTCGAAACTGCCGGAACGGATTACCGTTTGTTCCCGGTGG