Description :
From Genome Similarity Track
Location :
scaffold_240:13401- 16677
Transcript NameFunction/comments
Pl_107183hypothetical protein PHYSODRAFT_531138

Sequence
3276 bases(100 bases per row)
AACAAGCACAGGGCTCCGATAGAGCCAAGTGTTCGATAGACCCCCAAGGCGACATTCTGTTTGAGCATTTCGGTCTCTTCCTTCCCATCCTTCAGGCTTT
CTTCGGTCACAATCGTCACTGTCACTTCCGAAGCAGATAGAGGTATCACTTGAATCGCCATGGTATTGTCCTGAGTCTTGAGCTGTAGGTAGTAAATTCG
TGAGTGGCGTATTCGTTGTCAAGGCTTGAATCAACAGGGTGGAAGGTCTGATCCTGGTCTGAAGACAGGCGTGATCTGCATGACCATCATACTGTCCGCC
ACGCGTAAAGACTGCACTGACACACGGCATATGCCAACACCATCAGGACCAGAAGTTAATTGATTCTTGTTGCTCAGCATTGTCCTTAGCATTATAGAAG
TTCTACGTCGCTCTAGCTTAGAACGACGTCCATGATCTACATACGTAGAGTAGGGATCACATAGTAGGTCTGCTACAGATGGCGGGGTCACACGTAGAAC
AGTGCTCATCACTACAGTAAATAGAGGACGTTTATTGAGCACTGAAGAGAACCATTGAAAGTTCTCGTTCTAGCAGAGTCAGGAGTCACGGATATTACTC
GACAGGAACGTGGTGAGCGGAGGCTGATAACTTAACATGATGTCTTGAAATGGGCGCAACTTGAGACGAAGCCACTTGAAAATGTCCATCACTAACACCT
CGTTGCCACCAACAGGAGAGTGAAGACGTCTCCAAAGAAGGTGATGGTAGCGATGCCTCCGTAGATGAACCCAGAAGACACCAACGTGTACAAGACGCCG
ACGATGATCTTCTGCTTCATGCTCGTGGGTTGCTCCACAATCTCCATCTTGTCCGTGTCTTCATCTTTCGGTGTAAAAACGACCACCGTCACGTCCGAAG
TCGTTAGAGGAGCTACTTGAGCCATTGGCAGTTGGTGGGTGCTGGATATGAGCTGAAGCGAGCGAATTCCTGAGTGCGGTCTCAACAGTGAACGGCTCAC
GCGAATCTCCATTGGCGCAAGAAAGGCGAGATCTGTTAGGAACCTGGACAAGCGTTCCCAACACATCCACGTAACATATTAGTCCTAGTCACACGCATAT
CCGTTTCATTGGACTAACGTACTCAATGTCTCGTGGGACTCGTTTGGTAGATCTTATCATACATAGTCATTTACCAGTACAGTTAGGATAGCAGATCAGG
GTATGGGAAGTTGGCACCCGTGACGTGGTCAGGCATAACCGAGTGCTTGATCGGAGACGCGACAGTTGACGGAGACGATGGGGCGCTGTCCGTTTTGCTG
GTTTGGCGACGGAACTGCGTGTGAAAATGCTGGAACTGCTGCCGAGCACGAAACGCGTTAGCTTCCATCTGCTGCATCGCATACAATTCCTGGATCTGGA
CGGCGTAGCTGGCGTGGAGCTGCTGGAGTTTGGCTGCGAGCTGCTTCTTGTGACGACGCTTCAACTGCTTCCGCTTGAGGTAGTCATGCGCCACATTTCG
ACGCCAATTCACACCACTGGAACTTGACGATTTCTTCGAGTGTGAATGTGACGCACAACTGCAGTCCGGGTGCTTGTAAATACGCTCCCGCTCAGCCAGG
AAGTTCATCTTGAGTCGCTCGTTCTGACGCGAAAACTGCATCAACAAATTCGCCTGCTCAGTCACCGCAATAGCTCTATCAGTTTCGATGTTTGTATCTG
CGTTGGTCATCGTGGTGTCACTGCTACTCGCTACCGAAGCGTACTGATACATAGTTGCCGCAAGAAGTGAGCCATTGTCACTCACTAGAGGCACGGACAC
GAACTCAGGCTCGTACTGTTCCAGCTGCTCCAGCTCCTCATCCAGCTCGACGTCTTCTTCCAATTTTTCAGCAAGCTTTGCAGACTCCACTTGGTTATCC
TCCACAATTTTTTCAGGTTCATTCGCAACGACATCCTGCTTTTCCGCTTCAGCACCTGGCGACTTCTTGCGACCTCGCTTGTTAGAGACTTTAGTTGATA
CGGTCTTCTTTATCGATGAAGAAGCCGTCTCGGTCTCCTTGGAATCCTTCTTATTCACCTCGCAACTTTCCTTATTGACACTACCTTCAATGTCGGTGAA
CAAAGCTTGCGCCTTCATTCGTCACCTCGCAACTTTCCTTATTGATACTACCTTCAATTTCGGTGAACAAAGCTTGCGCCTTCATTCGATGGGTAGTCTT
CTTTCCGTTAGACGCATTCTTTGGCTTGTTCTCCACTTGGTTCTTACTTGAGCTCAACTGAGCCAAAACTGCTGCGGCATCTACAGCAGAATCCGTAAGC
TCGTCCTGGTTGTTCGATTGAGACTTTGAACTTGTAGCAGGGGGTGGCGTCCACTGCAATTCTTTCAAAGCCAGTAACTGCCTCTCGACTCGAGACAAGC
CAGGTTGCTCAGGAGTGTTCGGGTTTGAAGAACCTGACGATGACGAAATAGACACCACTGGAGATGCCGTGCTCATCGACAGTTTACTGCGCTTGGGGGT
AGTTACCGCTGCCGTATTGTCGCTAACCTTGCTCTTGTCGCCAGCCACATTGAGCTGTTTAAGGTTCGCGGTCTTCTTCTGTAGACCATTCTTGCCAGAC
GACAGCGCCTTCTTTTCTTCAGACTCAGACGAAGATTTTGACGACGTGACCTTCTCACTCTCTGGTCGGCTTCGCTTAACCTTACGACCTCCATCCTGGG
ACTTCGAAGCAACTTCTTGACGACTGCGCTTGTGAGACGTCTTGTCAAGCTTCTTATGGCGTTGGTGCTTCTCCTTTGTGTTTGTGCTGCCCTCAACGTC
GGAGTCGCTGCTGCTATCACTTTCATCTGAGCTGCTCTCTGCTCCACCAAGGTCTCGCATCACATTCCTCAGATCGCTCTTCACCTGAGAATACTCTTTC
TTCTGCTGGTTGCGATGCAAGAAGGCATCCAAACTGCGAACGAGCAGTTGATCTTGGTTGGCCGCTACAACCATCCATTTCTCCTTTTCCGTCTTAGGAA
GAGGTAGAACCGCAAGAAGTCCACTCGTGTTGACACGAGTAAGATCCGAGAACTGGGCCTGAAAGTCCAACGACGGGTCCACGAAAAACTGCTCGTAGCC
CTCGATGTAGTCGAGAGGTGTCGCCATTCCTGTCTCCTTTTTCGGCTGGTGGAAGAACACACTACCGTCGCTACACATACCAACCGTGAATGGAGATGCA
TCCTGACCAGCAACTTTGCTGACAGTTCGCATGTGACGCTGTCCAGTCGTGTCCTCAGCACCTCGTCGACGGCTTC