Description :
From Genome Similarity Track
Location :
scaffold_325:1340- 2364
Sequence
1024 bases(100 bases per row)
GGCGATGACGACGCTAATCTTTCTAGAGCCTCATCCTAGATGAGTGCACTATGTATATACCAAAGAAGTATCGTACTTAAGTGATCTGCGCGTATTCTTG
TGAAGGTGTCCGTGATGTCCAAGCGCGTATTTGCATGTGAAATGTCGCATAGGTCGCTTGGTCATGAATATAGTTGGGCTCATTAGACACCTTGCTTGGT
ATATTGCATTTTTTCAGCAGACTTAtccagagtgtaacggggttacatgtattTTTGTATAAAGAGTCGggccacacaagatgtgtGTTACCACAGCTTA
ACAaggagccactacgtggcgggtcTGCCAGCAGTTAAGTATtataattaggttttactatttaactAGGAGAGCCTATAGATTTGGGTATAGGCGGCTC
CGCCGCAAACAAACAAAAGGATTTCAAGTTAGATTtttaacggaagagtgtatttgccttgggttaaggttttcgGTACTTTGGAGTtaatggattgcga
tctgctacactcatactggttcttgtatagttcgtaaggttggtgaccttagcttagcttcctaagtaaagagctacggcagccccgctgcacagaGAGC
AACACCATTGTTTTGATTCATCTGAATCACATGTATTTCGATAGTATGCAATCTCGCGTGTGTAGGTGCGACTACAGGAACAGCCACTGACAGAAATTAT
GCAGTCTCCAGGGAGCAATAGTTTGCATTCTCTGGCGAAAGCGGTCGCGTAATTAGTAACATTTCCAGTCATAAATTGAATCCAACCAAAGCTAACTACT
GTGCAATTATAATAACCCACCAATGTTGCTTTATTTAGTATCGAGTCTTCATGTTAGGGCGTTTGGTTAGACGTGATCACGTACATTACACGGGGTGCCt
ctgttggaaacaagttatgtcgtacctaagtaaaccaggaggagtttTGAAACTCCCATAAGCATGATACATTTACTTGGAaacttaccttcaaaccacc
aggtccttccttcctatctgACAT