Description :
From Genome Similarity Track
Location :
Scaffold_2485:134- 2495
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2485-snap-gene-0.0Conserved gene of unknown function

Sequence
2361 bases(100 bases per row)
GTTGATCGAATACCTCGTATTGCAGCGAACGAATAATCATGAAGACCAAATCAAACATCTTGAACATTAAGCGCTCTTCTTTGATTTTGATTTACAGCTA
AACGTCATACACTTGGACAGCCAAGCCACTTCTCTTCAACTGGGTGGCAAGGCAAGCCTGCATGACGCAGAATTTGCATCTTTCGAATTGCAATGCTCGC
TGGTCTGTCGGTGCATGAAATCGCTTTCATGTGGTCATTGTAGCACATTGCGGAGTAAGTGACGCCAGAGGCTGTCGTTATGTTGCATTGACGGTACAAA
ACTCCACCACAAATATCGATTTCTTCTTTTGTCGGATCTTGGAATGGCGTGCTTGATGTTAAAGCACTGCTAGTTGCATTGTCGATGACGCCAGTAAAGT
CACCGCCACTTTGTTCCGAGCATATGGTGCTGCTGAAGAGATCAAGAATCCGCTCACTTTCATCGTCAATTCCGTTCACAGCACTGCTTTCTTCGGCGCA
AGTAACCCCTTTCGATGCATTGCATGCCCCAAGAACTCCATTGTAGCAAACAGGAACATTTTGGACAACCAGATAAGAAAATTTCTCGAGAGGAGCCAAT
CTTGGAAGATATGTCACATTGGACAACACTAAGAGCTCCAATCGCTCAAGATTCTGGAGGGACTCAAATGACGGCAGCTCTTTCAGCGAGGTGAGGACCG
CAAGTGTCATGGATCGAATATTCGATAACCCATCGAACGATGGCAACTCTTGGAGCAAGGTGTGACTTCCTAGATGGAGAAAGGTGAGTGTCGGCATTTG
GGAGAACATATCAGCTGGCATACTGACTAAATTCGTTGCAAGTGGATTGCCTGCAATATGACTGCAAGAGATAAAAGGAGAGTTGCCGGTCACAATCTAA
TCGTCTCAAATCAAATATTTTGTCCGCACTTACAGAAATTCTAGCTGCTTGAAGTTTTTAGCCCAGGAAGGAATGACTTCTAAAGATGTGGAGATCAGAG
AGCTAGATTCAACAAATTTTGTGTTAGTCACCAACACTAAATAGGACCATTTCACTGGAAATGTAACGTACATGTAATGCAACTTTGTGCAAAGCTGTAG
CTCCTCAGGCAATGCCAAGAGCTGTCGATTGATCAGTTGAAGCGTCCGCAGGTCCCCCGAAATCGCCACCATTTTTAACTTCTCTGTCGCATCTGGTGGA
TTTATCCATACTTCATATGTCTTTGGGGCCATATCCACATCAATGAATGCGAGGCATGGGCAATGTGAACCAGTTGTAACTCTGTGCGCATGTGCGACAC
ACTCTGGATAAGCTTCGCATAGGCCTCTTGACAACGCGACGCATATGTGGGTGTAGATGAGCAGAAAACAGGCAAACAAGGCGAAAGGCACAGCCATCCA
TCTTGGCACGCGCTTTTGGTCACCCGGGACTTCTCGGCTTTTGGACAACTTCTGTCTGCTTTGCGCAATTTTGACCTCCACTACACGTGTCAACCGATAA
CAAAACGCCATATTCATCCCCAGTCGAACGCAAAAATCGAGAGCATTTGCAATGCGCAGGCCATTGAAGCTTCGCAAAAAGAGCGTGACTTCAGTTGGAT
TTGCGAACAAGCGCGCTTGACGCTCAAAACTACCAAGTGGGGCCATTTCCAAGTTGATGAGAAACATCTCGCGGTCAAACTGGAAATGGTGGTAGCTGTA
GAGCAGCAGAATGATCGGCGCACCAATTGCCATCATCATGTCAAACCTGCACGCGTAGACAACACACGCAAACACTCTTAGCCCCATGAAGTAGTCTCAC
AGCAGCAATGTACAGGAAAGCATATTGTACATGGTGTCAACGAGAACTTCCGAAAATGCTGACAACTTCGAGGGGTTTAATATCACAATAACGCAGGAGA
GCGAGTTGGCAGCGACGAGAGCAGCATATGTGTATGCCATGGGGACAGGAAGTCCTCCTTCAAGAATTTGATGCAGCGTGATCAATTGCATAGCAAAATC
GGCGACTTTGAGCCAAGTGTTCTGTACATACAATAAATAATTAGTCACAGTGTAGCTTTGACCAGACTAACAGAGAAAAAGTTTGGGAGCTTACCCAAAA
CTTTCGATACACGCCCTCAAATCCGGTAAGCTCTCTCCAAGATGTCATAATACGTAGGGACGATTGATGCTCAGCTGGCAACACTCGAGGAATTCTAAAC
ACATTATTCCTGATGGTAAACGCCCGATTTCGCAATAGCGTCATTTTGAGCAGCACATGGCAGTATCCAAAGACAACAGCGCCGAGGCTGCTAAACGTGA
GTCCTCGTAGAACTGGTTTTTGGTCAATAAGGAGCCAAAATGCTCCGTCATCAAACTCTGC