Description :
From Genome Similarity Track
Location :
Scaffold_3704:134- 2223
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3704-snap-gene-0.1MID

Sequence
2089 bases(100 bases per row)
TCTGGATTCGTTTTCTAGAGTCCGTGCAGGTATCGAGCCACCCATTCTGGATCTAGAGCTTCGTGTTTCGACCGCTTCAACAGCCGTGATCATTGCACCA
GCAGGTTGCTGTTTTTCGTATCTTCGACGATCAGATCCTGTGTTTTCTACCTTTCGATCTTTTTTCGAGAAGCTCTTCATCCACAAAATCCGACGTTGCA
TGAAAGAAACACGAAAAGATTTTCTCACTCACGGACAGTCCGACAGCTACACACTCTCCGATCACAGCAACACGATAGCGTCTGAAGCACAGGAGTACAC
CATGATCTCCAGTCGAGGACCATCGCCAGAAGGAGCATCGTCCTCTCCAGCATCCCATCACAGCAGCACCAGCGATGATCACTACAAAACACCGCCCTCT
TCTGCTTCTCCACACTCGAGCTTTCTTTCCGACCTGGTGGCGACGCCAACAGGAACGGCCATACCTACCAAGATGGACTTCCAGTCGCCCATGCCACCGC
ATGCTCGTCTCGCGTCCGCAGCAATGCTCCAGACTCCTGCGGGCAAGAAGGCACTCGGTCTCATCCTACTTGAAGGCACGACGACACCGTCGCTTGAGCT
CCCCATGTCTTGCAACTTCGATGCGCTGAGCAACCACTTCCACTTGCCGCTCAAGCTCGCCGCCGAAAAGTTTGGCGTCCGAGCGACGGCCTTCAAAAAG
CGTTGCCGTGCCATTGGGATTCGTCACTGGCCGTACCGCAAAGTGCGCAGCCTCAAGCGGTCGCTACAGGAGCTCGGTCGCTGCCGTGACCAAGGCATAC
TCAACGACAAGCAGCACCACCAGCTTGCCGTGTTTCAGACCCAGCTTGACAAGCTCTTGTCGCCAGAGACGTACGGCATTGATCCGAGTGGTCGCTTGCC
ACCCGGGACATTTGACCGCGACGATGAAGATGATGAACACGACTCGGCCGGAGATGGCGACGATGACGACATGTCTTGCGCCTCCAACCAGAGTCCTCGC
GTCGAGTCGGCGGCGTCCTTCTCGGACTTCAAGATTACTTCCTTTCGCGCAAAACGCGCCAAAAAAGCCCCATCTACGCCGACGATGAACCATCTCCCGT
CCCTCAAGCGCGGTGACTTTTCGCTGCCGTCGGGTATCGTGACTTCGTCGCAGTATGGAGGCGACGGTGCTCCCTTCTTTCGTTTCCCTTCAGGAGGTGA
CACACAGACGCCCAAGGGGGCGGCCACATTCATCCACGGAGATGATCTCATGCCCAGCGTTTCGGTTCGCTTTGCACCGAACAGCAGCCAGTCAGGCCAT
GGGCTTCCGGGCTTTGAGTCGTACGATCCGTTCTTCCAGGATTTCAAGAGTGAGTTCGCGCTCACGATGGAAGACTTTGGGGGCGAAGATAGCGTCCCGC
CCGCCTATGGAGTGGACACGTCTCCCCATGACGACTTCTTTCCGTACATGCGATCGCCGACGATGGCTTCACTCCGTGCTTCCGCGACTCCGAACGGGGC
GAGTCATCGGTCGCACACGTCGACTTCACGCACCGGTTCGGGCGACAGCAACACGAGAAACTCGGGCGAGCCGAACGAGGCTGGGGACGACGACGTCTTT
CTTCAGATATCTCCAGACTACGGGTGCCTTGTGTAGTGTGCCGCTCAGCCTGAAGGAGAGTCTCGTGGGTTTGTTCGCTTGGCTTGAAGAAGCTGTTGGC
GTAATAGGAGGCCCACAACCCGGTGCTAACTTATTGCGGTCCATAGCCTTGTATAATAAAAAGTGCCCTATCAGTTGGTCAGCTCCCCGGCTTCCATTAA
AGTGTGTGTCGCAAACGAGCATCCAGTAGAACGAAAGTAAACTCGGCCACCTTCTGGGACATTGTCAGCGCGTACATGGGATTGTCACTCGTGATGCTGA
ATAGGTTGGGAGAAATAACGATTGCTGAACATAACACATAGATGAGATTGTCAAATCTGCTGACGAAGACGGAAAATGCGTGAACCACAACGGAGCGTAC
ATAGATTGCGTGCCGTCATTTTGTTGTGCTGCTGATTGTTTGCAACCTCCGCCATCAGATCCAACAGCCATCTCACGAGGCTTGCATGA