Description :
From Genome Similarity Track
Location :
Scaffold_909:134- 11675
Transcript NameFunction/comments
Phyag_g8658hypothetical protein PHYSODRAFT_537335
Phyag_g8659hypothetical protein PHYSODRAFT_353568
Phyag_g866060S ribosomal protein L38
Phyag_g8661conserved hypothetical protein
Phyag_g8662hypothetical protein
Phyag_g8663hypothetical protein PHYSODRAFT_469761

Sequence
11541 bases(100 bases per row)
TGTTTCTCTTGTGTTTCTGTGGGGCTCTAAAAAACGATACAGAAGAGAGTTCATCTCCCCTGAGGTGACTACCTACTTGGACTGAGTACGCGGGCGGCGA
GCAGTCTTGGGACGACGCTTAGTTGCACgcgtgtggtggtgaccaGTACGCGGAGTCGTCGACTCCGAGTCCTCCGAAGGAGTAGCGTCCTCGCTGTCTT
CTGTGCTCAGCAGTACACGGCGCGACATTTTACCGGAGGCACCGTCCTGCAGACACTCGAACTCCATCTCTTGGCCCTCCGACACCACGTCGTTGATGTT
GGTAACCTTGTCGCGCGAGAGTTCCGAAATGTGCACGAACCCACGCTGGCCGCCTGAAGACTCAAGGATAGCACCAAAGTCCATGACCTGCGTCACACGC
ATGGTGTAGCGCTCACCCTTGCGGAAAAAGAACGATCGGCCCTTGTAGGAACTCTCCTTGTCATTCTCACGAGTGTTACCATTGTCGTTGCCGTTGTTGG
GACGACCCGCGTTGGCAACCTCAGCAAGCTCTGTGCGTAGCCACTCGCGGGCCTTCTCGGCGTCATCAACTGCACCCACGACACGCACGATGCCTTCGCG
GCGGTCCACGATGCTCACAGAGACGTTGAAACGCGATTCCAGGTCACGGATGTTGCTGCCTCCGACGCCAATCAGCGCACCGATCATGTTCGTAGGAATC
ATGCACTCGAGGCTCACATTTGGTAGTGCACTGCCACCAGACTTCAGCGTTTCGCGGGGCTCAGCAAGCTCGTTGCTCATGCGACGCAGCACGTGGAGAC
GCGCCTGCTTGGCGTCGCGCAGACCTTCCTTCAGCACGGAAAGCGGCACGCCACTGGGAAGCTTGACATCTAGCTGCATCGCCGTCACACCCGTTGTTGT
ACCAGCCACCTTGAAATCCATGTCGCCGTAGTGGTCCTCAGAACCAAGAATATCGGTCATCAACTGGTaatcgccttcttcgatTTGCTTCTCTTGTGCG
AACGGGTCACCAGCAGTAACGAGACCGATGGCAATACCGGCAACGGCACGGCGAACGGGGACACCGGCATCCATGAGCGCCAGCGAGACACCACATACCG
TAGCCATAGACGAAGATCCATCCGAGCCCACCACCTCCGAGGTCATGCGAACAGTGTAGGGGAACTCAGTGATAGACGGCAGAATGGGCAACACAGCCTT
CTCGGCCAAAGCACCATGGCCGATCATGCGTCGATTGGTGCCACCAACGCGACCAGTCTCGTTCACACAGAACGGCGGGAACTCGTAGTGCAGCATGGCA
TTCTTGAGCTCCGTAGGAGCATTAGGCTCAGCCTGCTCACGCGCTTCATGGAGCGCGCCGCGAAGGCGGATACCACGCTCGAGAGGACCCAACGTCACAG
AACACAGCGTCTGCGTCTCACCACGAGCGAAAAGGGATGATCCGTGAGCCATTGGCAGCACACCAGCCTCCATCTCGAGTGGGCGAACGATGCGAACCGG
TCGGCCATCGACTCGCACCggtttgttcttcttcgtctccttggCAATGGTCAGAATACGCTCACGCAGCACACGCTGGAACGTGtcgtgagcagcacgc
tgAATAgccgcgtcgtccacagGTGGAGATGCGTTAGCAAAGTGCTGACGCATGCCGTTAAGCATCTTGCCGTAGACCTCACGCTCTCCTTGCTGACGGG
CAAGTTTACCAACACGACCGTTAGCGATCAACGCCTCAGCATCCTTGCGGCCCAGCTCCTCAGCCTTGGCCCAGACTTCCGGTCCGATAAACAGCGGCGA
GTACACGCGCTTCCTCTTGCCATGCTCCGCCGCAAgtttcttctgctccttaATCGCCGGCAGCACATTAGCATGTGCCAAATCCAAAGCCTCATCAAGA
CGCGCCTCCGTCACCTCGTCACCCGAGGCCTCCACCATAACAGCACGCTTCGCCGTTCCAGCGTAGAGCACATCCAGCGTAGCAGCATCACGCTGCGGCG
CAGTAGGGTTGACCACCAACTgtccatcaacttcaacgacacGTACACAGCCCACGGGTCCATTCCACGGGATGTCAGACATACtcagcgccgccgacgc
cgagtTAACTGCCACCACGAGCGGATCATTGTGAGGGTCGTACGACTGCACGGTCGCCAGCACCTGTGTGTCTTCGCAGTAGTCGCGCGGGAACAATGGA
CGAATGGCGCGGTCCACCACACgagactgcagcacctcctcgtcactgCCAGTGAACTCGCGACGCTTCTGGTTGTCCGGGATGAGGCCCACAGCGTACG
ACTTGACGCGGAAGTCCACCGTAAGTGGCAGGAAGTCACGTCGAGATGCGCCGCCATTGGCTGACGGGTTGCCATTGTGGTCGCCACTCACAACGGTCGT
AAGCAACACAGTACGACCGCATGAGGCCAATACGGCGCCGTCCGCGAGCTTGGCGAGCTTGTTTACGGTGTAGGCCGTGGCATCGGTGCTGCCAACTACA
ACCTCCTTGTCTTTCTTGGAATCCGGCGTCTGGTTCTGATTCTGATCTTGTGCaggcttctgctgctgctgcgtttgcaccttcttggccgctccttctt
cttctgcggctGGGGTCTTGGAGCCGAAGAGAAAGTCACGCAGCCCCAGGAACGTGCGGGACTGCGGCGCGGCGCCTGCGACGCGAGGAACGCGGTGATG
AGCTGCACTGATGGCAGCGCGGCGAGCCACAGCCGCGGCGGGCAGGCggcgagctgcagacgacagCATCTTGCTGCAAGCTTGATGATCAATGTGTGgc
tcgccaagcagcagtcgttTTTGAAAAAAATATACACAAGAAGTTGCGCTAAGAGCCATAAGTTGCGCTAAGTCCATAAAAACGGACAagtcgtgctcgt
gctccCGTTGCCGCAACTTAATGCAACACAAAAGCATAATTGCATTGAAACCAACGGAATTTTAGAGACGCTATTCGGCCAGCACGAACACCCAGAATTA
AGCCTAAACCGTTCCTAAATCGGCGCATAATATTGACCATTTAGCTCTTTCGTACTGGTCGGATAGCGGTCTCCGCGCGACCCACTTCTATTTCTCACAA
ACCGAAAAGCaggccgccagcaccagcgactGACCCCCGCGTTCCCCGCCGTCAAAGACCAAGACCAGACCAGCAACATGGGCACTCGTGTGTACGTGGG
CGGCCTCCCGCGCGACGCCACTTCGCGCGAGATCCAGGACGGCTTCAGCCGCTACGGCCACGTGTCCAACATTTGGGTGGCGCGCAACCCTCCAGGCTTC
GCTTTCGTGGTGAGTTGAGCTTCTTCCCCCTCGCcctcttctcttctcttcggCGCGAGGCCTCGCTCGCATGATGGCGCCCCGTTGCCTCCCCCTCCCT
CTCCCTCCCCTCCTAGTGCGCGGCTCTCGACattttgaagaagacgctcgtTATTCTGGCAGTTGGAAGCGCGGCGGTCTGTTTGTGGGCAATGCGTGTG
TGTGTAGTGTGTGTATAGTATATATGTGTGTACGTGTCGTTGAGTATCGCCACGTGACCGCCGCTTTTGCTGAGAGTCTCCTCCCCCTCCCTGGTTTCGC
CCGCCTCGTCGAGCTCTGAAGTCTCCTCCCGCCAGGCtgacgtcttcgtctcccGCCGTCTTCAATTGTACTGCTACTACTGTTGGAGGGAGAGATCGAG
AAAAAGCACCGTTCGCCTCGACAACGTGCCATCATGTGGCGCCTCGCCTCGCTTCGTGCCCACGCCATCAtgtgcatcttcatcatcttcttcgcctgtc
atcgataccaaccaacgcgtcgtcctccccattgctgctgctcccaCCTCTTCTCTAGGACTTCGAAGACCCGCGTGACGCTGACGATGCCATCCGCTCC
ATGGACGGCCGCGACTTCCTCGGCGGACGGTAAGGCACTGACTGATCcacttgtcctcgtcctggcTGATCTAACGTCTCGTGTGTCTTTCTTGGGTCCT
GTGCTTGATTAGCATTCGTGTTGAactcgctcgtggtggcAGCCGTCGTGACGGCGGTGGCCGCGGTGGCCGTGACGACGACCGTGGTGGCTACGGCcgc
ggtggcggtggtgacCGTTTCGAGCGTGGTAAGCAGAATTGTGAAAATATGATGCACTGCTGGACTCTAATATGGCTCCATTGCTTTCTAGGTCGCAACC
CGCCCCAGCGCACTGACTACCGCGTGCGCGTGACGGACCTGCCGCGTGATGTGGACTGGCGCAATGTGAAGGACTTCCTGCGCACGGGTGGTGAGGTCAC
TTACTGCAACATCGAGGCTGATGGATCGGCGTAAGTATTTTGTGCTGGGATGCAAGGTGAACCTGACTGTAGGCTCTAACGTGGTTGATTCGCTGGCATT
CGTTCAGTATTGCTGAGTTCCAGACCAAGGATGACATGGATGACgccgtcaagaagctggatGACACCGAGTTCCGTGGCAGCTACGTCCGCGTTGCCCC
CGAGGGAGACTCAGGCCACCGCTCGCGCTCTCGCTCCCCCGCTCGTGGCCGTTCGCCGAACCGTCGCTCGCGTTCGCGCTCGCCTGCTGCGCGTAAGGAC
TCCCCGCGCCGTTCGCGCTCCAGATCGGCCTcgcctgccgctgctcgctcGCCCGCCCGCAAGAACTCGGCTTAAGCTGGTGTGGATCGAAGATGGCTGT
CGATTTGCACAATAgcttgcagcaccaaatcAAGGGAGTCTCGGGTTGTTCGCGTGCACAGTGCTTAGCAGATTGAACAGCTTTGTTTGTTGCCTGGCGT
CGAATGGACGAGCTCTTTAACGATGGCAATAGCATCCTGTTTTATCACTTTTACCCGGGTGTTGTATCGTAGGAGTTTACGTCTTGCCACCTTGTTACCC
TTGCTTGTCAACACACACGTCAGTGGCATGCGTTGCAAAGCAAGAGGTGACAGTGATCATCAATTTCGTGCCGTGCCTCGACACCATCAAAGATCACCCC
ATGAACGCTCGCACGAGGACACTAGCCATTGCAGTGGAGTGGTGAATTGCAGACTCCGAAGACGACTACCCGTTGACCCTGAAGCTCTGAAACTCTGAAG
GACACACATTACAACTGATAGATGACAACCGAAtttgagcagcaacaaaaccgacgacaacaagaagcgatTGACCTGCGGATGAAGGAGATGGTATTTG
TGCCTCCCCTGACTTTCTCCTTTGCGTTCGTCCGTCCGGAAACGACCGAAGCGGAAAAGAGGAAGCTGTTACAAAAAGACACACCTGCGTGCCCTGCAGT
TCAGTCCCCTGTGGATCGTCGTCTACAGCGGACCTACCACCTGCCCCCAACGCCGAAAAAGCTTAAGAAGACCGAGCTTTATTATGCGCCGCACTTGCAC
GTTGCCACACCCTAAATATCCTTGCGTTGGAGTCCTGTTAACCCAACAAAACAGCACCAAAAATTAGCCATCGGTCATGAACAACTTGGCAAGGGCTGAT
TGGTGCGCACCAGGAGGCAGGGACTGCGTGAGCTTGTCGGCCTTCTCCGTGTCCGTCACGCAGAGCGTGTAGAGGTACTTGGAGCAGCGGATTTTGAACT
TGACCACCTTGTCGCTCTTTTTGATCTTGACCGAGCGAGCATCTTTGCGGCGAGCCTTCTGCAGGAAGTCGCGGATGTCGGTGATCTGCTTCGGCTGTCA
AAAGTCAAAGACGAACACGCGTCCGCTGGTTAGCTCCGTGTATGTGTGGcattgtgtgtgtgtttctCCTGTATTGCATCCATCTTCCTATCGGCAGGAA
GGCCTCCGTACCATGTTGCTTTGGTCTTCTAAACTCAAGTAAAAAAGCACGTGCACACACTGCGCCTCGGCGGCTTTGCCAGCCAGTCGTCTTCGACAGC
CATCGTAAAAAACACCCACTTTTTACACCTCGCACGCGTAATTACGTATTCATGTACTCCACACCATACGTACCGCGCAGCGCCAGTTTTTGACTTGAAA
CCTCCAGCTCTTGATTCCAGTATGCTGCTGGCCGGTTGTTAACGCCCATCGCCGAGCGCTCCACACGTTCGTTACCTGTATATCCCGCGAGCGCCCACGA
GCTCACGCCGCCTCTTGCCGCGATGGCGCCCAACCAGGAGTGCCACATATGtctcgaggagctgcgtcgcgaTCTCGCAGCCGCCCCGTGCGGCCACGTC
TTCCACCACAGCTGCATGCTCCAGGCGCTTCAGGTCAACACGCAGTGTCCCATTTGTCGCCGCCGCACGAACGACGCAGACCTCGTCACGCTCTACTTCG
ACGTTCCCAACGGCAACGAGCCTCCAGTCGATGATCTACAGCAGCTCAATCCCACACAGACTTCAGGCGAGAACGTGGCGCTCAGTTCCCGCGTTAATAC
GCTCATGGAGCGCATTCAATGgcagaacaagcagcaggagcgactcgtggacgagctgcggcgTCTGCGCAGTCAGAGCGAGCAGCTATTGGCCGATAAA
CAGACGCTGGCAATGCGCGTGGGAGGCCTGGAAGCGGCCAAGACGGAGTTATTGAACAAAGTGTCGCGGTATCAGATGGAACTGAGTCGACAAACGGAAG
CTGCACGCAGATCGAGTGTGAACCAGAGTATTATTAATTATCTGGAGAACTGCGATGCGTCggcgttggaggaggagatccagAACCCGAGAGAGCTCAT
TATGGCCTTGAAGAAAGCCTGCAAGTTCCGTCATGACCAGTATCAAAAAGTGGTGAAGGAGAAATCTCGACTGAAAGAAATGCTGAGAGATACGCAATCG
CAACCTGTACAACAGACTGGAGGGAATGCTAGAGCAGGCAAGAATAAGGTTCGACATGGAGCACCGCAGGCGTTCGAGACCAAACGCGCGTATCCGACTT
CTGGGACTTTTGGAACGGGTATTCAACCGCcgatggtggagaacaaAAAGAGGAAAATCGATGCGTCGTCTGTGGCATCGAACCCGATGCCATTTTACGA
ACAAGGCGATGATGGAATATTAGGATTCACTCCTCGAACGGAGTCGGCAGGTTCCCGTGCGAACGCCTACTCGGACGTATCGATCCGTCCGCCACCGACT
TCGAGGCAAACGTTTGGGCGCAGCAACTTTAACCCGAACCAGTATGGAGCGTTCAACTTGACGCCGTCGAGCCAACCACCCATACAGCTGGCGGGACCTC
AAGCGGCGGTCTGTCGCCGAGGGTACGACGAAACTGGGAAGCTGACCAACTTTTTCCTCCCAAAGGAGGGTGATCCACGGTCGTTACCTCGGAAGAAACC
AATTCCGAGCATGGAGAACCTACTGAACTCACAACCAAGAACTTCAggtcagcagcagcgcatggCGAGCAACGACCGACAGGAGTACGCACTGACAAAC
TGGCTGCGCAATAATTAAGGCGACCGAGGGCGGTCCGGCCTGTATTTTGCAGCTAGGACACGTGTAAGATAGTTATTTTGCAATGGTAGCGGCGGCACAG
CTATTGTGTCGGCGTTAAAACATAAGAGAGGGATAGTTACTTCGTAGTATTCGCACATATCGTCTCGTGCATTGATTGCCTAGAGTTTTTCTTGAGATGC
ATGCAGCTGCGCGCGAAGCCTTTTcagcgtctcgtccagcatggTTTGCTGTTCCTTCACAACCTGGGCAACCTGCAGATCTTCGGTGGGGAAGTTTTTA
TCGGGAATAAGACGACGACCGATCTCGTCAATAGACATGAACGAAATCTCTGTAGTGTGCTTTTCTTCCTGCGGCTCAAGTGCTGAGTCGACCGGTGCAT
GAGTTTGGCTCGAGCTTTCATCACTTGTGTTCGGCTGAGCGGTTGCTACCGGAATTGACCATTGCCTTCCAAGAAACGAAGCCTCTGGAGGCTCCGCAGG
TGCTGGCAAAGGTGAAAGTTGTCTGCAGACACAGTAAAGCAGTGTTGCCAAGCTGGTCAGGCTCGCTGTAGCCTGCTTTCCAATGTTCTTGGGTCCGATA
CCCACGTTCCAAGGTTGCAAGATTACATGAGGGATCAAAATTCGTACGAGTAGAAAATTGACCATCACCACGTTGAATCGCGAAAAGCCACTGCCTTCAC
AGGTAGCCAACTCCCCACTACGACCGCTTTCGTCCTGATCAACCAAGTTGGTTCCGTCCGGAACAAAATCCATTCTTCGGGTAGCACCAAGATCATCGAA
TTCAAGACTTTGTCGTTCCATGTCGAATAGTTGATACTGTTTCATAGTGAATGCAGAGCACGGTCAGTCTCGGACATCAAGGGATCTAGTTGTAAGTGGC
TCAACGTACATTGGGCGGGAAGTAAACACCGTCGGTGGAAATTCGCTTCCAGAAATCCAACACACCTGAAGGTACTTCTTTCTTATCGATCGCCTTGCCC
AGCGCTCGAAGAATTCCTATCAATCGCACTTTCAGCTTGAGCAGTTTTGCTGGATCCACATTACTGTTAATATTTCCaggaggagggcgacgagCAAGAA
TACCGCCAAATTTCTTAGCAAAGCCGCGCAGGCTAGAACCTGCCAGACCACTTCTCGAGCTGATATCCACGTCTAAACTTTCCTGTAGCAGCGAAAGTAG
TGGTGTTCTAATCACCTTTCCTAACCACATCCGAGTTGCATCAAAGTAAACACGCAGCACCGCCTCAAAGTCCTGTGCACATCTTGTGTTAAAGAAAGCC
AATTACCATGGAGCAAGAACTACAACATACCCGCATCGCGGCTTCTTTTTCTGCCATTTTCTTCGACATCAACTTTGTTTTGAGTTGCACAGCGAACATA
ATAGCAAGTACAACCGAACGGAAGATTTGAAGAGGTTCCATCGCTTCTGAATCCTCGGAGTCGAAACGCGAGACCTCATCACTTTCAGCTTCGGCCTCAA
GACGCCAGCGAGGTCTTCGCAAGGCACCCCCACCAGCATTTTTAAATGAGGCACTAAGCAATGCCTCCAGTTTTTTGCGGCTCTCGAGGCGGTCACGAGC
TTTTTGATCTTTTGACGCATTAACTTTCGCTGTGCTCGTACTTGCAGAATCATCAGTATCCTGTGAAGTGTTCTTCATATTCGCATTGCCATTTCCCAGG
AAGTCAGGTTCGTTCTCAAGTTTGTCGAGTGCCTACGTTTAATAGTTCAGGCAACGAACGAGAGGGTTCACCAACATCAACCGTACGTACcttttcatct
tcatctgTCCATTCAAATTCGGGAAGCCACGACAGGGCAGTCGGAGCGTGGAACGTCACGCGCTTTTTATCTTCGTTGTGTAATTCTTGCGGTGCTAGAG
CGGAAGATTTCATTTCTTCGGCGCCGGGACTAGGATTGGCCTTGGTAGTGCCAATTGGGATTGTTGGCGTGTATGCCAGGTCGCCGTCCGAGGCGTTTAA
CACACTTGAATCTTCACTTTACGGCCATTTCGGTTAGATAAGCATCCCATAAGACAATAAAACCAAGAAGATACCTACTTCCTCTGTGGACGAAGCAGTG
ATATGATCTGTTGGTTTTGCTGTAGCAGCCTCTCAATCGTGCTTTCGCTAGATTCCGACAGACGCTGCTCTAAAGACAATGATGATCCTTTCGTGCCTCC
ACAATTGTCGTTAACATGAGCAGGATCTACGCTTAATAGATTGGACGTCTTCAGCTGGGAACCGTTTTAAATGTTACTTCATGTAAGCTTGACCGCACGC
AACATTAATACGCACCTCGTAATGATGAACTTGTTGCTCTAGTCGTTGCATTTGGGTTCTGTAAAACGCACGTGTTCGGACGAACAGCTCAATTAATACT
CACTGAAAGAGATCCACACTAGAAACAGTTAGTACCGCAGCTCCTCTCGGCGCTCTTTTCTGGCCTcaacgagctgttgctgacgCATTCGCAACAATTC
ATGCTGCAGTGATTCTTGACGAAGTGAAAGGGCCGCGCGTTTTGCTTCTACTCCTCCGAATTGTTGGAAGTACAGATCGCCCAACGCCATAGTTCCTGCA
TGCCCATAACCTGGTGACGAATGGCTTTTTTTGGCCTGCAAACCACACGAACTACGGTGAAATGATTGTATTTCTCCGCTCGAATTGATTCCCGATCAGC
TCGTTGCTGTCACTTCATCTTGCTCTTGAACGGTATGAGCTCCAACAGGGGCGGCAGCTTGGGTAGcattcttctcctcttcccTCTTCCTGTCCTCAGC
TTCCTGTTCTGCAATTTCCTTCTTTGCagtttcttctcgtcctAGAAAATCGTTGGTCAACGACCGCTGCAAGTCCTCAATCTCGTGGAAGAGCTCAAGT
GACTTCTCCAGGATCTGCGTAGCTGACTCCAGCGTGTTCTTTGATGTCTCCAGAGTCATGTTGGTAAATAGTGTGCTCGCTTTATAAGCTCCCTCCGTCA
TTGTATCCTGGACGTCACGAATCTAAAAGAGGGCAGTCGCAAGAAGTTAGAAGGCACGACCCACAAATTTCAGCACTGTAGCATTTCTCGTTTACCTGGC
CCGACAGATCGCGCACTCGCTTGGAGATATCCCCGTAGCGACATTTCATTTTGCCGCAGATCACTGGCAAGGACGACTCCGCATCGCTGATATCCACCAC
ACCGGGTGTATGGATTCCTTGCCCAGCAAGACGATCACCCTCCGGAACGTAGGTAAGCAACGACGCCTTGAACGTGCACATTCCTGTTTTCTTCAGTCCA
TACAAGGTTGTGTCGGATTCCGGGTTACTGGAAGGAATCAGCTCCACGGTCATGGAATAGTGGTCGTTGTCCATGCACTCGTCTCCGTCATCGTAGACCA
TGTACTTGTAGTTCAGCGTGATAGGATCAATTTGCCAGCCACGGAAAATGCTGTCAGACCGTACACAAACAACGTTAGCAACTCACCAAAGCAGCCTTAG
ATAATTATCTTGTAAAACTTACCCCAGAATAGTGGGGATCTCaggctcctcctcctcctcgtctgACACTGGTTCTTCCAGCTCGGCAGTGTCATCATCT
CCACTCTCCGTCGTGCCGGGAGCATCAGGAATACCCTCAGTCATTTTcacctccacttccaccttctcgtcgatcttcgcCTCAATTGTTACGTTCGCTA
AAAGGCACAAGTCCAGAATGTACCTGCAAAAATGTTAAATAACAGTGATCTTAACAGAAGAAAATCATTAAGCAATAGAAAGAGGCATTAAAGCTTACGC
TTTGCCCTCCTTCATCTCCCTCTCCTCACGGATGCACGGCAGGGACTCGAAAGTATCGACAAAAGGTCCTACAAAGCGCAACATAGTCAATTAGCCGCGT
AGTGGTATACATTTTACAATCAATTAGCTTTGTGTGTCATCGCAACATGCCTTGAAATGCCGGAAGTGGATCGCGGGACGGGATGGGGATCCGCACGGGC
GgcacctcctcttccaccCGCGGGCGAGGGATGATCCGGATGTCGACTTTaggaccagcagcacacaaCGCGCTGCTCAGCGCCACAGCGACCGCCACAC
TCGCGAGCACACTCCTGCTCCGCATACTTGTTCGTCGTGGC