Description :
From Genome Similarity Track
Location :
contig_19:133976- 135851
Sequence
1875 bases(100 bases per row)
GCTCGACACCTTGAATTTGTTGCACGTCAGGCAGCTTCTTACGTAATCGTTGACATCAGTCTCCAACTCCTTCCAATAGTACCATTGTTTCACTCGAGCT
AGCGTTCGTGGTACGCCTGGGTGTGCTGCACCATCATGGAACTCAGATAAAACTTGCGTTCGAAGCTCATAGTCATGTGGTACACAGATAGCGTCCACAT
TACCTTCCATTTGGCGATACACAATGTCATCTTTCCGATAAAACAACCCACCTTCCATACTTCGAGGTGCATTGTCTAGAATCGGGCTGAAGTCTGCATC
TGTACGATACCCAGCAATGAAGCGCGAGCGCATTTGTCCGGATAGCGCAATCGCTGTAGCATACCGTGTAGTAGCGTGGACCTGAACCGCAACCTGTTCT
TGAGGTACAACAGGACTCCTGCGGTCAACACTCACCCCTCGTGATTGATCATCTAGGAGAAGATGCAAGTCATACGAGTTGCGAGAGACAAGCGCGTTCA
TGACCCGTTGGTGATCATCAATTCGTTTTTGGGCATGACTGCATGCCTCAGAACATGTGTGTATATCGACAGTGCTCACTTGCACAGCATGATCATCGCT
AGTCCCCTGTACTTCATCTTCGACAGGTTCATCACTAATCTGCTCGTCCAATTTTGCCTGCATGTCTTCAGGGTCACCTGGAAGGTGGCGCGACAAAGCA
TCGGCAACGATATTTTGAACACCTTTCACATGATGGAGTTGAAAATCGAACTGTGCGAAAAAGTCGAGCCACCGTGCCAATTTAGATGACACTGTCGGGT
GGTTCAGGAACCATCGGCATGCAATATTGTCTGTATACACGTGAAAATGACGCCCATGCAAATAGTGGCGCCACTTGCCAAGTGCAAGTTTTATCGCGAA
CAGTTCTTTTTCGTGAGCTGGCCAATTCAACTCGTGATTGCCCAATTTCTTGGAGTAGAAGGCGACAGGGTGGTCAAAACCGTCGTGCCGCTGAGATAGA
ACGCCCCCACAGCACTGCTTAGACGCATCGGTTGTCACAACGAACATCACGTTGAAATCCGGCAAGCGGAGAATCGGAGCTTGCTGTAGTGCTGCCTTAA
TTACCAAGAAGGCATTTTCTTGATACGGAGTCCACTGCCACGTTTTGTCTTTCTTAACGAGATTGCTCAGTTGTAAAACGATGTCAGCAAACCGATGAAT
GAAGCGTCGGTAATAGCCAGCAAGTCCAAGAAAACTCTGCAGTTCCTTTACCGTAGTTGGCGTTTTCCACTGCTCGATAGCTGCAGTCTTCAGCTTATCG
ACCTCCAACCCTGCACTTGAGATTGTGTGTCCCAAAAAGTTGACGGATGTCCGCGCAAATGAGCACTTCTCAAGGCGGGCGAAAAGCTTTTCGCGGCGCA
GGATATCAAAAACCGTCCGAAGGTGCTGTGCGTGTTCATCCATCGACTTGGAGTACACGCAGATGTCATCGAGGTAAACGACTACGTAGTCCAACTTGCC
TAATAGTAGCCTCATTAGTCGAGACCAAATGCCTGGCATGCCAGCAACACCCATAGGTGCGACGCACCAGTGATAAATCTCGTTTCTAGTCCGAAAAGTT
GTGTAAGGACGACTTGACCTCTTTACTCGCATCTGATGGTAGCCTTGGGCAAAGTCAATCACACTGAAAATCACTGCACACGCCATTTGATCGAAAAGCT
CGTTAATATTTGGCAGCGGGATTTTTGGCACGAGTGTTTGCGAGTTCAGATAGCGATAATCGACAACCCACCTCGTAGGCGATGTAGTGTTACCACTCAC
GTCGGCTCTGCTGTTTCCCTGTCTTTGGGTCACGTTTAGGAATCCCAAACACGTTTGACACCCATGGCGAATCGC