Description :
From Genome Similarity Track
Location :
Scaffold_307:13397- 14453
Sequence
1056 bases(100 bases per row)
TGCGCATCTTACGTTGCAGTTCAATAGTGTATGCGTTGCCTAAACGGCGCGGTACACGAAATGGACCGATGAACTTGGGTAGTAACTTGTTACTATCCAT
GTTAGTCACTATGTGTCGAGGTAGGTTTACCATAGATAGTAGGACTAGGTCAACCTTCATTGAATAAAAGAACATTTTCCCTTCCATTCTTGTCTGCGTT
TTTCTTTTTAGTCGGTCCACTGCTTCTGCAATGGAATCTTGCACGAAACGGACAACCGCTTCGCGAGCCAGTATGAATTCATCTGCTGACTCGCTGTCTT
TGACTTTAGTGCGCTTGGAGCGCACTGTGGCAAGATCAGTGCCCTGAGTAGTAAGAGCATCCTCACTCTAACTTTCCTCTTCTTCACCGAAGTCGATGTG
ATCGACATCGGCATCATACGTAGTGACCTCGTGGTCAGTACGTGTTGAGTGAGCACCGAGCTGGCGTTCGCTCGAACGATTACCCCCCCGTCAAACTAGA
GTTACAATCAAAAAAGGTGGGTAGGCGTGGGTGGCGCAAGCCATTTACAAAGAACGGTGTATGCGTCGTCGATGCATGCACCGAGTTGGTGATGGCGAAT
TCCACTATTGGCAAGAAGTCGCTCCAATTCGTAAACGAATGGACGTAACCCCGAAGGGTTTCCTTAAGATCGCGGTTGGCACGTTCTGTCCGACCATTTG
TTTCAGGGTGGTCAGAGGTCGACATCTGAAAGCGCGTTCCGAGTGTTTTGAACACGGATCGCCAGAATTCCGCAGTGAACCGTGGGTCTCGGTCGGAGAC
GAGTTCACGAGGCAACCCATGAAGACGAAAGATCGTGTCAATAAAAACACGAGCACATGCCGACGCATTGATGGATTCAGGTACGGCGACCAGGTGTACT
ATTTTACTGAATTGATGAACGAACACAATAATACCTGTATTCTTGTATGGGTCTCCGGGGGATTCGAAAGACAAAGTCCATTGAGACAGATTCCCAGCAT
TCCGCCGGAATGGGCAAGGGTTGCAATGGCGCACGAAGTGAAGGACCAGACTTCAC