Description :
From Genome Similarity Track
Location :
contig_21:133924- 135428
Transcript NameFunction/comments
g4551.t1hypothetical protein

Sequence
1504 bases(100 bases per row)
ATCCGCGCGTTTTCCTTCGGTGTCGTCCTCGCTACGGGTCTTATCCACATGGTTAACGAAGGTGTCGAGAAGCTTCGTGATGAGGCGCTTGGCTCTATCG
TGGAGGAGTACGGCTGTCTGGGTCTCGCGTTTGTGCTGATTACATTGATGCTTTTACATTTTATCGAGTGCGAGAGTGTCGTATTTTTTGGAAGCCAGGG
CTCGACGCTGCATGGTCACGGCCACAGCCATGGACAGTCAAATGATCACGCTAACGGGCACGAGTCCGACGACAGTGTCCGAGACCCAACCAGTACTCGG
AGTGTTGATTTCCATGCTCTTCAGCCCACCGACAGCCCGACACCAGGCAAAGCGAACGATCACGGCCCCAACGTCCAGCGCAAAATCGCCACCATCATCT
TCGAAGCTGGAGTCATCTTCCACTCTGTCATCGTCGGACTCGACCTTGGCGTTACCACTGGAACCGAGTTCAAGACGCTGCTCATTGCACTCTGCTTTCA
CCAATTCTTCGAGGGCGTCGCCATCGGTAGCGCTGCACTCGCCTCTATCAAGAGCCGGAATAAATTGTTCATGATCAACCTGGCCTTCGCCATCACGACA
CCCATTGGCCAAGTCATTGGCATCGGTATCCGCAACTCGTATTCGAGTGAATCGACGACTGCTTTGTGGGTTCAGGGTGTCTTCGATTGTGTTGCCGGTG
GGATTTTGCTGTACACTGGTTTGGTTGAGCTGCTGACGTACAACATGACCACGAACCAGAAGTTTTTGACACGCAGTACATCACAGCGCTTCACGTTGTA
CATTAGCTTGTGGATGGGCGCTGCGCTCATGGCCCTCATAGGCAGGTGGGCTTAACTGCGCTGCCTGGTATAACGCGCATGCTGGCGGAGATTTGCTTGG
TTTGCGATCTAAGGAAGGAATAAGTTGTATGAATTTGGGACAATCGCTGTTCATGGTTAATTTTGCTCGAAAGCAATGCAAATCATCATGGTTCAAGAAA
CCTTGACAAATCTCATCATCAGCCATTCTTGCATTTTTGCTGTTCTGCATTGCACATGAGATGTTTTAGCAAGGAACACCAGGTAAGAGGCCTGAATTTT
TACCATGCTACTGTAGTACTTCGAAGTATTATACTAATTGAAAAGGTAAGCTTATCCGCCCAAAAGTCGATATAGGTTTAGCGAGAGCCACATACAAATT
ACAAAATACCTGTTGCAACGGGTAAATCTACTTGAAAATAATACTTGGAGAGCGAAATGTGTGCCCCCGAACTTTGCACGTAGTAACACTTCTTGTGGTG
CCATTCGCGAAACTTGAATAATGCTGCTCACGTGGTATTTTTTGGAAGCCAGGGCTCGACGCTGCATGGTCACGGCCACAGCCATGGACAGTCAAATGAT
CACGCTAACGGGCACGAGTCCGACGACAGTGTCCGAGACCCAACCAGTACTCGGAGTGTTGATTTCCAAGCTCTTCAGCCCACCGACAGCCCGACACCAG
GCAA