Description :
From Genome Similarity Track
Location :
Scaffold_2070:1339- 3147
Sequence
1808 bases(100 bases per row)
GGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCGCCTGTTTGACCAGAATGGAGAAGTCCACTTTCACGTGGAGCGGATCCTCCAGGAGCAA
AGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGAACTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGA
AGGCTGGCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGTCCCAACGGGGTACGGCCGATGAATACATACCGTACCCG
CGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGCCCCTTGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTC
CAGGATGCGGAACAGCAGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTTAAGAGTCTCCACCCATGCCCAGAACATGTCCTCACAAGAA
CGCCACGTGGGACAGCTCTCGGGCATAACCCAGGGGTATCCCCAAAGTGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCT
TAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAATAAGGGCTCGTTCATAGATGCC
CCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGTCAATACCCTCTTGAG
TTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCTCCGAACCCTCACGCACACGCTGGGCAGCTTGGAACTCCTCCTGCTGCTGGTCGTCGAGGTCATTCG
AGCCCTCCCGGGGCTCAACGATAGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGTCGAAGATACTCCGATAGGAGCGACG
AGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGTCTTCGTCTTTAGATGCCTTAGCACGCGCAAGACCCTCG
GCAAGCGAGAGATGTTTGTGAGGATTCTCTTCCTCATCGCCACCAGCTTTGGGAGCGCCCTTAGCCTTGACGGCCGGACTCTCAGAGCGCACAGAGGTCC
TGGGACTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGTCCGCAGGAGC
ATCGTGAGTGCTCTCGGACTCGGCATCGTCTTCCCTGCCCGAGTTGAACTCACGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAACACGAGGGCGAC
GGACTGCGGCGCCTGCTTGCGCGCTTGTCCGCAGCCGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGTGCAGAGCCTT
TGCCGTGAGGCTTAGTGCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTCGCAGTGCCACGAGGCATGATAACGGT
CGAAGTGGAGACATAGACGAAGAGCGCACAGATTGCTGCTTGATGCTCTAACTGTGAAGTGAGCCTTTGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTC
GACTTTGAGAATGAGAGTTTGTGACGAACGCCTCTTCATTCTGATTGTTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAA
GTGTACCC