Description :
From Genome Similarity Track
Location :
Scaffold_2949:1339- 2557
Transcript NameFunction/comments
Phyta_totarag14962hypothetical protein

Sequence
1218 bases(100 bases per row)
GTAATAAACGCCGAGATCGCGCGCGCTCGATCAGTCATAGAGACCACCCAAAATCCACTCGCCAGGTCCAGGGAGCAATACCAGAGGACCTTGTCAAGAT
CGTTGATAAGAGGCCATTAGTCGGGTCAGACTGTTGATCAGGCGATAGTCGATACAGAGTCTAATGTCGACTCcattcttcttgacgatcACGACGATCG
GGGACGCCcatggcgacgtcgagtgTCGGATGATCTCGGCCGACAGTAAACCCTTGATCAGCAGGAACAACTTCTCGCGGAATTGCGGAGCGACCTTGCG
GATCCGTTGAACTATCGGTCTTGCGTTTCCCACTTCAATGTAACAGATCGCTCCCTTCGCAGCAGGTGGCAAGGCGTTCCCCTTCCCAATTAGAAGGTGT
CGGCGACGCCGTATGATCTTCACTAGtcgctcgatctcttccgGCGTACTGTCCTCAAGGTTCCCAACTTGGATATCTTCGGTCTTGACTTCTTCCGTCG
TCAATGTGATCTCCGGCAATACTGCCATGTGACCCTCGAGATCTTCTGCGTATAGCTCCCCTCCTTATTTGATGTACACCTGTTCGTCTTCCGCATGTTC
TTCTGCGTAATCATCAGCGAGATCTTGTTAATTCTCGTCCGGGTCTTGTTTCTCGTCCGGGTCCTGTCTTAGTGTCTCAGATTTTTCTCCAATCCCTGCA
GATCGATCTAGAATGCATTTCTGATTTTCACCCATCTGTacacctcgatcttggcaATCACTTGAATGCTGACGTCTGCAATCTTTTGCATACATCACCC
TTTCTGCACCTGGGACTGGGCACTTTGTACACTCATCGATGTTGACGTGTACCTTCCCGGCCGACGATAGACACGCGTTTCTTCCGCCGTTGGGGCGCCT
TCTCGCAAAATCCCGGCAGTGttctccgccgtcgccactGCCGAGCACTGCCACTTTTGGCGGTCGCTCCGGCAGCCGGGGCAAGATCATAGTCGGAGTC
TTGTACTGTGGCTGATCCACGGCGGGCCCCTGTGGTTCCTCAAGTTCCTGGCGATCTTCACCGATATCCACCGTCGCCTGGTAGGCCAGGTTCTGCCATT
CAGCATACCTGCGCGATCCCACCGAGACATAACCAGGTAAGCGGAGTACCCGATCTCCGGCCAGCCACATTCCGACGCGCATGTTGCGATCCAGTACTAA
CTTGCGATCGCTCACGTT