Description :
From Genome Similarity Track
Location :
Scaffold_1:133882- 136200
Transcript NameFunction/comments
g33.t1hypothetical protein

Sequence
2318 bases(100 bases per row)
GTTGCGGTGCCAGCCCGCCTTCCGCACGCAAATCGAGCCGCCAAGAAGAACGGTTCCGTCATACCGACAGATGGCCGGCCTTCACAGCACAGGACAACAT
TACAGAAGGCATATCACGGCTTCGCCTTCTCGAAAGATGGCTACGCTGGTGCCACCGAGACACGGTTGCTCATGAGTCGGAGCTCCATCACAAGTGCAAC
ATGAGTGCAAGACAGTTAGATCCTAGTCTCGATCCACATTAGTACATAGACATTACCCCTTCATCGGGAGTTCTATGTTGCCATCTCCCCTAAATGTTAG
CATTGTCACTTACTGATGCGAGGGCTGGGGAGGAAGAGGCACCACATTGCCAGCATCGGCGTAGCCGATCCGAGACTGAAACTTCGAGTTATTCGGTGAG
AAGAACAGCAGCTCGTCGACAGCACGATGTCTTCCCTCAAACGTCGTGGGTGCATCAGCTCGAAAGGCAGCGGCTCGACGAAGGTATAATCTAACGTATC
AGTCGCCTAGTGTTAGAATTCGCCACTGCGCCTTCATCTCCATGCCCAGTAGTGGTTTACCTGGCTGTCGCTGCTTCCAGTCTCATGCAACGTTTCAGCC
TCAATGTACGCCCCTCTCGACGCCAAGACAAACGAGATCGCTGTCGTTTAACCCGTCGGTATCTCTCCACAAAACGATCTCCGTCTGGCTCCGTCGCAGC
CACGAGTCGAAATGCGAGGCGATGAGGACTACAGCGACTCATCCGAGCGACGCCGCGCAGGTTCCTGCCCAGTCGCAGGCTCTTCACGGTTCCGGATATG
TGCGCGTCGCGCTCCAGCTGCTCTTCCCGTCGAATTTCCTCCTGCCTCGCTGCCTCCAAGACTTCTTGTGACGCTGCCACATCTCTATCGTTCGTCTTCT
TGGCTGTAGCCGCATCAACTCGCTTCTTTTTGTTCGTGCGTCGCGCCACCAGCCGCTCGTACCTGTCAGGAGCGCACACAGCATCAGCACAACGATGCAA
ATGCTATAGCAATTCGGTAGCGGCGCATACAGGCGGTTGAAGTCGTCCTCGGCCATTTTGACTATGATATCCTTAAGTACGAAACAAACTTACAGGCAGC
CACAGGTTCATTAATCGACGTCAAGATGCTGCGCGTGTCCGGTCTACTGCGGGGCTTGACGGCGGCACCGCTACGTCCTCGCAGCATCCTCGGAGGCTGC
TCGACTCGCTGCTTCAGTGTGCAAAGCGGCGATGATGACGACGACGATGACGACGATGACGACGATGACGACGCGCTGGAGGAGCTGGACTGGGACGACC
TGGACGAGGACTGGACGCTAGACGACGAGGGCGACGCGGCCTTGGCGGGGCGTCGCAAGGTCGAGGAGCACGTCAAGCAGAAGGTGCGCGTGCGACGCGC
GCAGCACTCCAAGCGCCGCTTCGTGGACCGCATCCGCGTCAAGGCCACGGGCGGCCACGGAGGCAATGGCTGCGCCAGTTTCTTCGCCGAGTCGGCCATG
CGCAAGCGACCAAATGGCGGACACGGCGGTGCTGGAGGAGACGTCCTGATCGAAGCCTCCGACAAGATGCAGAACTTGGCGAACGCCACGCACCACTTTA
GGGGAGGCGCCGGCACCAACGGCATGGGTACGTGCATGGGATTCATTTGTGTGCTGCAAATACTTTTTCAGGGTACTGACTCTTGCGTGGCTGGCGTCCA
GCAAATGATTCTGCTGGAAGGAGAGGCAAGCATTGCCACGTCAAGGTGCCGTGTGGTACACTCGTCAAGCGCGTGGAGCGCTACGAGCGCGAACTGGAGA
ATGGCGAGTACGAGATTGTGGACCAGATGGAAGTGGTGTGTGATCTAGACGAGCCTGGAGCGACGTTCCTTGCTGCGAAGGGCGGAAAGCCTGGACTGGG
TAACCGCATCCTGGCAGGCAAGACGACCAAATTCGGACGGCTGCGCAAGCACATGCCGGAGAACAAGACGACGGGTCACCCGGGTACCTCGCAATACTAC
GAGCTGGAACTCAAGACCATCGCTGATGTGGGTCTTGTAGGCTACCCGAATGCGGGCAAGTCGACGCTGTTGAGCGTTCTCAGCCGTGCGACGCCTGAGA
TTGCACCTTATCCTTTTACGACGCTTCACCCATACGTGGGAATTGTGGAGTTCCCAGACACGTTCCGCTTGAGTGTGGCTGACATCCCTGGACTTATTGA
CGGTGCACACCGCAATGTTGGTCTTGGTCACGATTTCTTGCGCCACATCGAGCGCACAAAGGTGTGTGTGTATCATTGATCTGTCTCCTCTACCTGGGCG
ATGAGCTAACCATGGTGT