Description :
From Genome Similarity Track
Location :
scaffold_93:13385- 15531
Transcript NameFunction/comments
Pl_109940hypothetical protein PHYSODRAFT_437914

Sequence
2146 bases(100 bases per row)
TGCTAAAACACGATTCCTTGCAATGGGGATCGAATTGTTGCAGCTTCTTGTTAGCTATGAGTCTGGGTTGCACGAGAATGCGCTACAAGAGCTTACACGA
TGTCTGGTAGGTGCAATGGAGTTACGCCTAGCAGTTGCTGAAAAAGACTTGTTCGCCGGTGGTTCTACTGCTGACGAATCGACCTTATCTTCATCGTCAT
CTGCTCCAAACATGCTGTATGAGCACGACGAAGCAGGAACCGATCTTGCTATTCCATACGCGCCTGGCACCCCACTAGGCTTCACATCCCGTGTGTTGTC
GCGATTTCAAACTTCTGCATCTCATGGTAATCTATTTCACGCGTTATCGGGGTCTGTGAGCAAAGCGACACTGGGGTCAACATCAACTAACACCAATACC
TCACAAGTACGCCCAACTCGCAAAGATCGAGCGCGGCTACAAGGATTCCTGCGCGAACTCTTTGACTCCGAGTTCACGTTGCTACACAAAACCACAACAG
CATTGAGTTTCTTGGTACTACTCGCACCGACCACAGCATTGGGCCAACTCGTGGAAATGCTGCAAAACTTGCGTGGATGCGTTACGACGGTGGGCGGTGA
TTTTCGACCTGACGCATTTGTAGCCGTATTGGAGTTATTGGGAACTATAACACCTATGCTACATGCACATCAAAAACACAGTGTGTTTTCTGCCCACAAA
GCGATTGTAGAGGCTTTGCTACTGGGCTTCGAATATGCAAAATCGAAGCAGCTTGCTTACCTCGCTTTCCGATTGCTGTGCCAAGTGATTTACCAAAGTA
ATCGCAAGGAGCGAATCTCTCTTGCTGCTCTGGCGATGCCAACCTTGCAACAGTGCACACGTCGCGCGAACAGTCTTCTTGCTGAGGCAGCTGTCGATTT
CTTGATGTGCTATGCGTACTCCCAGTCGGTTTTACCCCCATCGGCACTTTGTACTCGACAACAGCGTGGACACGAGGGGAATCGAGCGATGGATGATTCG
TCTCAAACCAGATCAAAATCCTGGGTGTACAAGAGATCATTACTTACGATCATCACAAACTCGCGCGGGGATGCATCACTCGTAATCAGGAGAGCTAATT
GTACGAGCCATTGGGAGCTTGATTCACGTCACAATCTGTTGCTGGATCCGGCAGACTCGCGCCAATTATTTTCGAGTTCGTGTGGTGTGCGTAATGAATC
TGGTAGCTATCCAAAAAGCTCTGATAAAGGATACCAGCGACCAACGACGATAATTGGATCAAGAAATACTGTCGCCCATAAACGGTTAGCACTCCCGGCA
GAGCTCCGACCGTCATTTTCGAGCCAATCGAGCTCGTATTTTAAAACTAACGCTCAAAGTTCAGATACAACAAAGAGTAACTCTCGCGCTGAGGATGATA
CAAAAACTGTGGTGGACATGAATTTCAAAGACATACAGGTGGATTTATCTCTGGATGATACGGTGGCACACTCCTATCAGCACTCAGCTGCGGCATCAGC
ACTACCACGACCGCTCCCAGCGTATGATGGCATTGGGGGATCACCATCGTATTATTATGAAAATGCACAAGGTACGGAAAATGGTGTGAATACGGTATGT
TTAGGACTAACTTTATATGTATTTGCATCGTTTTTGGTTGTAGTGAGTCGCCCTAGAAATAGTACAAGGCATTCCAGGCAATCTGAAGGAGACGATGGAC
AAGAAAGTTCGTCAAACAAACCTACTATTCGTGCTATTCGGGAAGATGTCGAAGAAAACGATGGCACCGAAAGCCAATTACGACATGTGGAGAATGACCA
AAGTGGAAGTGAGATGGATGCATTTTCACTCGATGACAGTGTCAAGGATGCACGCTGTGTTCCAGAAGTTGCACCACGATCCCTACAATATGCTGACTAC
AACACATCTACAACCACTGGATCAGCTACCGCCGGAAAGATGTGTGAGCCCTCGACATTGCATCGTGAGAACCAGTACGACCCCATGTATTTGATGATGC
AGCTATTCGATCTTACTATGGAAAATCGGCCCCAGTTGCTCATGGATGGGCCATCACTGAAGCTGGCCCTCAGCGTGCTGGATCGTACTCCAGAGTATGA
GACGCACAAAATTGGCTTGTTGTACGTTCGAGGTGAGAAGCAATCT