Description :
From Genome Similarity Track
Location :
Scaffold_23:133816- 136232
Sequence
2416 bases(100 bases per row)
GAAGTTCTCAAGCCATCCCGATCGACGGGTACACAAGTTGAACTAAACGTACCAGGGCAAATTCAGATCGATATGCCTCCTCCATATGTCGGCAAGTCTG
GGAAATATGGAAGGCCGCCGTTCGCATCGAAATTTTTGCGATGACGGTTTCTCCACAATGGTGCGCGTGCCCAGATACTCTTTGACCTCTACACAATACC
GTGACGTCAATGGCGAAGATGTCAAGTTCAAGTTGGAACCTGGAATGAAGTGTTCTCAACAGAGGGATCGGCGCAGAGACAAGAACAGGCACTATACTGA
GATCGTTAGAGTTTCAGAAGGAACTCCCTCGACAAGAGATTAAAAGGGGAACGTCGATCGAAAAATCTGGAAGAAAAGCCTCAACCCCCTCCCATGGACC
TTTTTTTCGGGGGCCACTGGAGATCTTTCCGCAAAAAGCTATCTGCCGGATGAAATATCCGATGACGAAAGTCCAACACATTCCTTTGACCACACAACGT
CCGATGTTAAGAAGACGAAGACAGTATAAAAAGTCCAAATATACGTGAGTAAAGATAAAAGCTCCAGGATCGGAGGGCGAAGAGTGAGTAAAGGTCAAAG
ATCGGAGGCATTTAAAGTTCGACGACCGCAAGATTGGCGACCGCGTACAGTCCAACATGATAGTCGTAAAAATCGAAGATTGACAAAGAAGACCGAAGAA
GAAAAACTATCGCAAATTGGAGCACCGAAAGTAGACTAAAAGCTACAAATGTGGGATCAAGTGTAGTGAGAGGGTAATGAAAGCAAAAGATAAAGAGCTT
CCAATGACTGATCCCGTTCTCTAGATCTTGCGACCAAAGCTAATCGTATCATTTAATGAACCAAAACGAAACCTAAGGAAGTCACTACTACAATTGACGC
TTAATACATGCGCATACAACTAATGATAGAATCATGTTTTCATCCAGAAGATTTTGGATGCGGATGATCTGATTACATTCAGCTGGATCGAATTTGTAAT
GTGGATGAAGCTCTCGTCGAGAATATATGTCCCCTAGTAAGCAGAGCAGTTTAGGCCATACCCCAAGACTGCAAATCTTTCGAAATCTTTCGAAGAACAT
CATAAGGGGTCGTCTCAATTCGCCCCGGTATTCGGAGGTCGGATCAAATGACTCAATCATCATCTGTCGCATGTCTTTAGGGTCGTCATTTACATCATTT
TTTCACGATGGACGTGACCAAGTCAAGATTAAACCTCAGATGACACAGATCAAGACCTAAGACCAACCGATTACCGGAGAATTAATCACATCATCTGTCG
GCAGAGGTAGTACCCACATGCAAACGTGCTTTGAAGAGGCGAAATAGAATTTTGTAGACGAAAAGAAGAACTTAATTCTCCAACCGACTCGCCCACCAAA
GTCCCGTATTGATGCTAAATAAACTGATGTGCCTAATGTTTCAATAGAACCTGTGGGATCGCTCTACAGCGGACTAAGTGAATAAGATTTGGACGATGTG
TGGACGGTCGAACCGAGATGCACTCACATTTTACTACCAGAGCAACAGGATCCGGCATGAACGCGACTCAGAGGATCATAGTATCAGCAATCTCATATCT
TGAAGATATTTACGGAAAGGATAGGGAAAAAGATCAAGCGCGGAATCCTATTGTAAGATGGTAGTCGCTGCTAGAATCTTTCCTGATAGATTACTGTGGA
AATATAGTATTGATTGGTGAAAAATATTTCTACGCGCGCAAACATCCTAAGGAAACATCTTGGGATTACCTATACTTTCTCAATAAGATATGTATGCAGT
AAAATTACCTGTCAAAGATATTTGAAATGATTTGGAAAAGAAAATGGGGACTACTTCATCGACAAGCTTGATGATCACGATTTGGCCAACCAGTTGTTGC
TGCTACGTGTGTAAGGTGCGGGTGCTATGGAAATTACATTGCGCAAATACAAACGTGGACAGTTTCGCTAAGGCAAGGAAGCGATGGGACAAAAAATAAC
GACAGAAGGGATCGTCGGTCAAAGCATCAGTACCCTAAAAATATACTCGAACGATGATAGCGATCCGAGTTGAAGATTCAGCCAGTATATCAGAATCCAA
GATTAGCAGGTTATAGCTCAGACATGATCAACAAGCGGCGAATCTGGCAATTACGCCCGGTCGCAAGACACTAAACGATATTTCTGCATGCCCAAAGACG
AGCGACCATGCTGACGATTCAGATTGTTCAGTACGAGGTCCTCCGTTGAAACCATATACTCATTGAAGTTTGATCAGACAAACGATCTAGGGTGCTGGTA
ACGGTTGCGTGCCAGAAATGCAGGCGTAAACGTTTCCCATCCGATAAATGTTTTATCGTGTGCCACGCATGCGGGGAAGCGCATGAGAAGGGCAAGGGTC
CGATGAAAGAGTCATA