Description :
From Genome Similarity Track
Location :
Scaffold_1:133792- 135864
Transcript NameFunction/comments
g33.t1hypothetical protein

Sequence
2072 bases(100 bases per row)
TTTCCAGAGTACTGGCACCTCGCCAAAGAGACCATCAAGTTCAACCTTGACCGCAAGCTCCTACAGTGGAACGACAATAGCAATGCATCGGTTGCGGTGC
CAGCCCGCCTTCCGCACGCAAATCGAGCCGCCAAGAAGAACGGTTCCGTCATACCGACAGATGGCCGGCCTTCACAGCACAGGACAACATTACAGAAGGC
ATATCACGGCTTCGCCTTCTCGAAAGATGGCTACGCTGGTGCCACCGAGACACGGTTGCTCATGAGTCGGAGCTCCATCACAAGTGCAACATGAGTGCAA
GACAGTTAGATCCTAGTCTCGATCCACATTAGTACATAGACATTACCCCTTCATCGGGAGTTCTATGTTGCCATCTCCCCTAAATGTTAGCATTGTCACT
TACTGATGCGAGGGCTGGGGAGGAAGAGGCACCACATTGCCAGCATCGGCGTAGCCGATCCGAGACTGAAACTTCGAGTTATTCGGTGAGAAGAACAGCA
GCTCGTCGACAGCACGATGTCTTCCCTCAAACGTCGTGGGTGCATCAGCTCGAAAGGCAGCGGCTCGACGAAGGTATAATCTAACGTATCAGTCGCCTAG
TGTTAGAATTCGCCACTGCGCCTTCATCTCCATGCCCAGTAGTGGTTTACCTGGCTGTCGCTGCTTCCAGTCTCATGCAACGTTTCAGCCTCAATGTACG
CCCCTCTCGACGCCAAGACAAACGAGATCGCTGTCGTTTAACCCGTCGGTATCTCTCCACAAAACGATCTCCGTCTGGCTCCGTCGCAGCCACGAGTCGA
AATGCGAGGCGATGAGGACTACAGCGACTCATCCGAGCGACGCCGCGCAGGTTCCTGCCCAGTCGCAGGCTCTTCACGGTTCCGGATATGTGCGCGTCGC
GCTCCAGCTGCTCTTCCCGTCGAATTTCCTCCTGCCTCGCTGCCTCCAAGACTTCTTGTGACGCTGCCACATCTCTATCGTTCGTCTTCTTGGCTGTAGC
CGCATCAACTCGCTTCTTTTTGTTCGTGCGTCGCGCCACCAGCCGCTCGTACCTGTCAGGAGCGCACACAGCATCAGCACAACGATGCAAATGCTATAGC
AATTCGGTAGCGGCGCATACAGGCGGTTGAAGTCGTCCTCGGCCATTTTGACTATGATATCCTTAAGTACGAAACAAACTTACAGGCAGCCACAGGTTCA
TTAATCGACGTCAAGATGCTGCGCGTGTCCGGTCTACTGCGGGGCTTGACGGCGGCACCGCTACGTCCTCGCAGCATCCTCGGAGGCTGCTCGACTCGCT
GCTTCAGTGTGCAAAGCGGCGATGATGACGACGACGATGACGACGATGACGACGATGACGACGCGCTGGAGGAGCTGGACTGGGACGACCTGGACGAGGA
CTGGACGCTAGACGACGAGGGCGACGCGGCCTTGGCGGGGCGTCGCAAGGTCGAGGAGCACGTCAAGCAGAAGGTGCGCGTGCGACGCGCGCAGCACTCC
AAGCGCCGCTTCGTGGACCGCATCCGCGTCAAGGCCACGGGCGGCCACGGAGGCAATGGCTGCGCCAGTTTCTTCGCCGAGTCGGCCATGCGCAAGCGAC
CAAATGGCGGACACGGCGGTGCTGGAGGAGACGTCCTGATCGAAGCCTCCGACAAGATGCAGAACTTGGCGAACGCCACGCACCACTTTAGGGGAGGCGC
CGGCACCAACGGCATGGGTACGTGCATGGGATTCATTTGTGTGCTGCAAATACTTTTTCAGGGTACTGACTCTTGCGTGGCTGGCGTCCAGCAAATGATT
CTGCTGGAAGGAGAGGCAAGCATTGCCACGTCAAGGTGCCGTGTGGTACACTCGTCAAGCGCGTGGAGCGCTACGAGCGCGAACTGGAGAATGGCGAGTA
CGAGATTGTGGACCAGATGGAAGTGGTGTGTGATCTAGACGAGCCTGGAGCGACGTTCCTTGCTGCGAAGGGCGGAAAGCCTGGACTGGGTAACCGCATC
CTGGCAGGCAAGACGACCAAATTCGGACGGCTGCGCAAGCACATGCCGGAGAACAAGACGACGGGTCACCCG