Description :
From Genome Similarity Track
Location :
contig_147:13378- 14579
Transcript NameFunction/comments
g14322.t1hypothetical protein

Sequence
1201 bases(100 bases per row)
CTCGGGCGGCAATCGCCGACGCCTCGTTGATCTAGTCACCGCGGACACCCGGACAATACTGTCGTCATCCTTCGGCTTGAGAAGCTCATCCAGACGGTTA
AGTGTGACCAAGTCCTGCCGATCACCCTCTGAGGTAATCACAGTTCCTTCTTCTCGTTGGAGAGCGGTGCTCGCTAACTTGTCTGCACTCTGATTCCAGT
CTCGCTTCATGTGCAGGAACTCGTGTTTCGGCCACGATCTGAGCCGTTCCATTGCCTTTTGGCGCAACAGCAACAGACCTGGTGCCTTACACGCGATCTC
ACCACGCATCTGGCGGATCACCAGGTTGGAATCACCGCAGATCACGATCCGCCCCCGGTCCAAAGTCGACAGCAGATCAAAACACAACAACAACCCGCGG
TACTCAGCTTCGTTCACGGTCAGATCGGGCATGTACTCCGACGCGGCTGACAAAATTGTCCACTCGGGGAGCTTCCATATGATCGCACTGTAAGCCCCAC
CGCTACGTTTAACACGTGCTGATCCATCGAAGCTCGCGACTAACAAATTCTCGTCCGCTTCAACCGTAGGGGGTGGCATGAGGATCGTTTGTCGAGGCTG
TTTCACCGGCGCAATCGCGATCAGCGCTTCGTCTACTTCAGCGCGAGGTGTGATGCTTGCTGCAATAGCGCCGAGGATTTCATCTTCCCCTTTCGCGCAT
TTCCGGATCTCTAACGTCCACTCTGAGAGCAGCGCAGCCCAGTTGTCGAGTCTTCCCTGGAAACCGGCTGAGTTGACTAGCCAAGCCAACGTCGAGTGCC
TGGACAACACCAAGATCGATCTCGTCGTCAGCAAGGTGTAGTTCACGTCCAGCATCCGTAAAAGCGCCAAGACTTCCTTGTCGACGATTCCGTAGTTGAG
CTCGTTGGACTTCAAAGTACGACTGGTGAAAGTTACTGGCCAGTACACGCCATCATGCTCTTGCACAAGTGCCGCAGAGATCGCCCACTGACTCGCGTAG
ACCACGATCACTGGAGTGCGATCGGGATCGAAATGCTTTAGGATCGGTGTGGACACGATTTTGGCCTTCAGCATTGTGAACGCGATCTTCGCTCGGGTCC
AGCGATCAGCGTCCGGAATCTGTGGTTCGTCGCCCCCAGTCATTTGTCGGCCAGGGTTGACCCTCTCTAGACGCGATCTCATGAAAGTCCGCTTCGCGCA
G