Description :
From Genome Similarity Track
Location :
Scaffold_10:133764- 143564
Transcript NameFunction/comments
Phymu_g810polyribonucleotide nucleotidyltransferase, putative
Phymu_g811hypothetical protein PHYSODRAFT_353568
Phymu_g81260S ribosomal protein L38
Phymu_g813conserved hypothetical protein

Sequence
9800 bases(100 bases per row)
CACTCGTCATTTTTCCAGTTTGCCGGTAACCAACCAGTCCACCACTTCAAGACCACAGAAAACACTCTTCCAACATCTTGGTGGAAGAATGAGTATCGCG
ACTCCTATCGATGTCACAATTCGTGTTGAAGAAAACAACCCCAGGACGTACACGTTCAGAAAGGTCACTACAGCTCGCGGTATATACAcaaagcagcttc
cagtcaCGTTCAAACCCAAATGGGCTTCATGCTGGACGGAAGATCGCCGCGTATACCCGCGACCACCCCAAGGGGAAGGAACTGAGTGCCCGTCTTACGT
GAGCACTATCTTTCTGCCGATAACGCTTCTCTTTAAGCTTATCGGGTGGATCATTTTGTCCCCGTTCATCATTATCTTCTACAGTGTAAACTTGGTCAAG
AGTCTCGTTAGGCCATGCCGTCTCGGTAAATCGGATCCCGTTGTGACCCGGTCTCAGTTCTACTGCTGGATGGGGCGAAATGGATTTACGAGTGCAGAGA
TTAAGACGGCGAAGCTCGAGATAGCAAAATTGCAAATACAGATGCATGGAATTGCTCACAAACTGACGGACGTTCGAGCGGTGGAGGACGCACTGAAGTT
GCAGTCCATCGAGAAACAGAAAAAAGTGGTTGGCGTACTCCAACGATCGATCGCAGCTATCGATAAAATACACGCAAAGCAGTTCGAGAGACTTCAACAC
GTTGGTCAACGATGGTTATTTTCTTCACTATGACCCCAGAatggacgacatcgagcGGACTGTGAACAAAAACAATGGGAACAGAGCACGATTACACTGG
AACGAATTTGTGAGCAGAAACAAATTGCACCACAACGAGTTGCTGGAACAAGTCCACACCGCGGCGCCGTTCATCAAGCAGTACATCACGCACGCAATTG
TTACGGAATCGTGCTGCGAGCGTTTTGTGCGCATTATGTGGGCCTGgtcactgctgctgataGTCGTTGGAATCAAACTCGCCAAAGTGATATTGAAGTT
TGATATCGGCAGTTTTGGCGATGTTATCGGGCTCATCGTTGGCTCAGTCACGGATGTCAttgaagctcctgctgcgctACTGGACATGCTTGAAAATGGG
CTGCCGACAGATACTGAGGGTCTCGGATCTGATACTGGGTTGAGCGGATCATTGGAACAGGTACGTCTCGACAATAGGGAGGCACGTCTTGACCAGCATC
TGGACGCGTTTCAAACTCCACGAAACACGAGGAGGTGAACGAAATCTCGGACGACCAGAACACCTAGGCAGTACAAACGAGCTTGGAGGCTGCCTTTATA
TATTTTGTATCATGCATAATACATACAAGTACATACGTACATGGGAACTTCAGATGAGCGAGTGTTCTGGTTCAAATGTTTCTGTTGTTTCTGGTTACCG
AGTGAGCTCTAAcacaagaagacggtgatATCGTCaaccttcttcagcagcaactacCTATTTTGACTGAGTTCGCGGGCGGCGTGTCGTCTTGGGACGG
CGCTTCGCCCCACcagaagctgacgacgatCGACGTGCATGGTGGTGGCCAGCGCGTGGAGTCGTGGACTCAGACGTCACAGAGGAATCTGTTGACGCTT
CCTCGTTATCACCCACACCCAGCAGGACACGGCGCGACATCTTGCCGGAAGCTCCGTCCTGTAGACACTCGAACTCCATCTCCTGTCCCTCCGATACGAT
GTCGTGAATGTTGCTGACCTTGTCACGAGAGAGTTCCGAAATGTGCACGAAACCGCGTTGACCATCCGAAGACTCTAGGATGGCTCCGAAATCCATGATC
TGCGTGACGCGCATGGTGTAGCGCTCACCcttgcggaagaagaacgaccGACCCTTATTGGAGTTGTTCTGGTGGTCATTATCACGactgctgttgtcgt
tgccgtcaCCGTTGTCCTTGCGTTTGTTCGCAGCGGCAGCCAGCTCGGTCTGCAGCCAGTCCCTAGTCTTCTCAGCATCGCCAGCTGCACCAACGACACG
AACAATTCCTTCACGACGGTCAACGATACTCACCGATACGTTGAAGCGCGACTCCAGGTCACGAATGTTACTACCTCCCACACCAATAAGCGCGCCAATC
AGGTTCGTGGCAATCACGCACTCAATACTCACGCTCGGCAGCGCACTACCACCGGTCTTTAAACCCGCGCGAGGCTCAGCGAGCTCGTTGCTCATGCGAC
GCAGCAAATGTAGGCGGGCGTGCTTAGCTTCGCGTAGTCCCTCCTTCAGAACGGAAAGCGGCACTCCTCCAGGAAGCTTCAcatccagctgcagcgccgt
tACACCAGAGGTGGTTCCTGCCACCTTAAAGTCCATGTCACCGTAGTGGTCCTCTGATCCAAGAATGTCAGTGATCAACTGGTAGTCGCCCTCCTcaatc
tgcttctcctggCCAGCAAACGGATCGCCAGAAGTAACAAGACCAATGGCGATGCCTGCAACAGCACGGCGAACAGGAACGCCGGCATCCATAAGAGCAA
GGGACACGCCACATACCGTGGCCATGGACGAAGATCCATCCGATCCAACCACCTCCGAAGTCATGCGGACAGTGTAGGGGAATTCAGTGATGGACGGCAG
AATAGGCAGCACGGCCTTCTCAGCCAACGCACCATGGCCAATCATGCGCCGGTTAGTGCCTCCAACGCGACCGGTCTCATTCACACAGAACGGGGGAAAC
TCGTAGTGCAGCATAGCATTCTTGAACTGTGCAGGTTCATCCTGCTCACGGGCCTCGTGCAGTGCACCACGAAGGCGGATGCCACGCTCCAGAGGCCCCA
GCGTCACGGAACACAGCGTTTGCGTCTCACCACGAGCGAAAAGGGAAGACCCATGAGCCATGGGCAGAATACtggcctccatctccaacggACGTACGAC
GCGAACCGATCGGCCGTCGAGGCGTACACGTTTGTTCTTCTGAGCTGTCTTTGCCACAGTCAAAATAGTATCACGCAGCACACGCTGGAACGTGTCGTGG
GCCGCACGCTGAATAACCGCATCGTTTACGGGAGGATCCGCAGTAGCAAAGTGCTGACGCATACCGCTGAGCATCTTATTGTAGACTTCACGCTCTCCCT
GCTGACGGTCGAGTTTACCCACGCGGCAGCTAGCAATCAACGCCTCAGCGTCAGCCTGACCGAGTTCTTCAGCCTTGGCCCAGACTTCCGGCGGAATGAC
CATCGGGGAGTACGggcgcttctccttgccATGCTCAGCTGCCAGCTTTGTCTGCTCCTCAATCACCGGCAGTACATTAGCGTGCGCCAGATCCAACGCC
TCATCGAGACGCGCCTCCGTCACCTCGTCACCTGAGGCTTCAACCATAATGGTACGCTCAGCCGTGCCGGTGTAGAGCACATCCAGTGTCGCGGCTTCGC
GCTGTGGGGCAGTAGGGTTGACCACCAGTTGTCCATCCACCTCCACGACACGCACACAGCCAACCGGTCCGTTCCACGGGATGTCGGACATGCTCAGCGC
CGCAGACGCCGAGTTAACCGCCACCACAAGTGGATCATTATTAGGATCATACGACTGCACAGTCGCCAGGACCTGCGTATCTTCGCAAAAATCACGCGGG
AAAAGAGGACGGATGGCACGGTCAACCACACGGGACTGcagcacttcttcatcactgccaGTGAACTCCCGTCGCTTCTGGTTGTCCGGAATCAGACCAA
CAGCGTAAGATTTGACACGAAAGTCCACAGTGAGCGGCAGGAAATCGTTCTGACCTGATTTTCCACTAGCTGATGGGTTTCCGTTGCGGTCTCCACTCAC
AGTGGTCGTAAGTAGCACCGTACGTCCGCAAGAGGCCAATACAGCTCCATCTGCGAGCTTGGCGAGCTTACCCACAGCGTAAGACGTAGTATCCAAGCTT
CCGACCAcacgctccttctccttcttgggctgctgcGTCTGATTCTGATCCTCTACAGGCTCTTCAGTCTTCAGCGGTGTCTTGGCGACCTCTTGCTCCT
CACTGGACGGCTTGCTGCCACCGAACAACCATTCACGGAGCCCAAAGAACGCGCGGGACTGcggagcagcaccagccacaCGAGGAACACGCTGATGAAC
TGCAGATATGGCGACACGACGCGCCACAGCCGcgcgtggaagacgacgagcagcagttgacaGCATCTTACTACCGGAATGTGCGGCAGTGCTGGCGAGT
CAAAACTCTGGTGTGACGTACACCAACCAGCGCGAAACCAACCGATCAGAAACTGGATCTGAATATTAACCAATAGAAAGGCAGAATTCTTCAGCTGTTC
TTGACCCTCTTCTTGGTCACAAACCAAGAGTTCCAGTCCGCACCAAGCAACGCTTAGGCGCCGACCTCGACCTCGCCCCCCCCCTCTTCCCAGACCTTTT
AAACCAGAACAACATGGGCACTCGTGTGTATGTGGGCGGACTCCCGCGCGACGCCACGTCTCGCGAGATCCAGGACGGCTTCAACCGCTACGGACACGTC
TCTAACATCTGGGTGGCGCGCAACCCGCCGGGCTTCGCTTTCGTGGTgagttgagctgcttcttccgtctTCTGGCGCAAGCTTTGCTCGCATGATGGCG
CGTTTCCTCCCTCTCCCTCCCTTTATTCGTCTCTGTTCGTCCAAGCAGGAGTGCGGTGGTCAATTCGGTGGCAAATTGTGTGTTTATTTGTATTTCTGTA
TACTATACACTAGTGTATACATGTGCCACTTGATCTGCTGCAAGCTCCTTCCGGATCCATGACGTCTtcaatgtgctgctgcttctaTGGACCATTCGCC
GTCTTCAGCACTTCCTTCTATTGGAGAGGGAGATAGAGAAGTCTCCTATTTGTGGATACGCAACGCACGTGCCATCATGCGTCACGCCTCGCTTCGTTCC
GCCATCACctgcatcatcttcttcgcctgctccGATCCGAACCATACCAACCAACGcctctccatcgtcgtcctctccatttcctgctcctccacctctt
ctAGGACTTCGAAGACCCGCGTGACGCTGACGATGCCATTCGCTCTATGGACGGCCGCGACTTCCTTGGTGGACGGTAAGAACTAACAAGGGAATGTTTT
GTTCTTGCGTAGGGATCTGACGTTTTGTGTATTCGGTGTCGTTCTTGATCAGCATTCGTGTCGAACTCGCTCGTGGTGGCAACCGCCGTGAgggcggtgg
tggtggccgtcgtggtggtgacgacgacCGCTACGGACGTaatggcggcggcggcggtggcggcgacCGTTTTGAACGTGGTTAGTTGCCATTTTGGATA
GTTTTCCTGTGTCTGTGCCTAACTAACTGTTTGTGATTGATTGGAATTTAGGACGCAACCCGCCCCAGCGCACTGACTACCGTGTGCGCGTGACGGACCT
GCCGCGTGATGTGGACTGGCGTAACGTCAAGGACTTCCTCCGCACGGGTGGCGAAGTCACCTACTGCAACATCGAGGCTGACGGCTCTGCGTAAGTTCTT
CGGTTGTTTGTGGTAGATCGCGGACCACTATACTGACATTGTGCACGCGTTTGCTATCCATAATGTAGCATCGCTGAGTTCTCGACCAAGGACGATATGG
AAGACgctgtgaagaagctggatgaCACGGAGTTCCGTGGCAGCTATGTGCGCGTTGCCCCTGAGGGTGACTCGACCCGCCGCTCGCGCTCTCGTTCGCC
TGCCCGTGGCCGTTCGCCGAAccgtcgctctcgttcgcGTTCGCCTGAAGCGCGCAAAGACTCCCCACGTCGCTCGCGTTCCAGATCGgcttcgcctgct
gctcgttcgCCCGACCGCAAGAACTCGGCTTAAATGATGTGGActgaagaaggtggagggCCTGATCATTCGTCACGAAGATGGTCTTCGATTTCTGGCG
TTGCAGGTCAAGCTGCTTTGTTTGTTGCCAAGCGTCGAAGGTTGTAAGCACATTAACCTCTTAATCGATGGCAAAAGCTTCCTGTGTTATTACGTTTTAC
CTTTGTAGCGTTGTTCTTGCTTGACGTACAAGCCGCGACTGTAGAGACTTTGACCATATAAGTTGGGTCCGTCGGATATCTGTCGTATACAGCGTCGTTC
CCGTGAGCCAAATGCGAATATCGTAACCCTGTAGAGCCCTAGCCTAGGTGCTTGGAGCACACGCGAATATCCTGCATATACGAATAATTCTACGACCACC
AGAGGTAACAAGACCAACTAGTCTCGTCCAACAAAGAGCGATACGATAGCCTGTGGATGAAGGTGATGATATTTGTGTCGCCCCCGGTTCCCCTCTGCGT
CCGTCCATCGAATGAGCGAGCGGAGTAAAGGAGGAAGCTGTTACGAGAAACACCCCTGCTGTGCCTTGCAGGCCAGTCCTTTGCTGATCTTCGTCTGCAT
CGAACACACCACCTGCCCCCAACGCTGAAAAAGCTTAAGAAGACCGAGCTTTATTATGCGCCGCACTTGCACGTTGCCACACCTAAATATCCTTGCGCTG
GAGTCCTGTATCACACGAAAAGCAAGTAGAAAAACGTCAGTACCTGGCATTCTTAAGCTGCAAAAAGCGCGATAGCGGGCATACCAGGGGGCAGAGACTG
CGTGAGCTTgtccgccttctccgtgtcCGTCACGCAGAGCGTGTACAGGTACTTCGAGCAGCGGATTTTGAACTTGACGACCTTGTCGCTCTTTTTGATC
TTCACCGAGCGCGCATCTTTTCGGCGCGCCTTCTGCAGGAAGTCACGGATGTCGGTGATCTGCTTCGGCTGTGAGGAGCGCAAGTCAAGGCACGACACGA
CACGTTAGCTGtctgcgctgctgcgtccCTGTGGGCTGCTCTATAGGACGTATCAAAAGCCACGGCCGCGTACCATTTTGTTGCGTTGGTCTTCTAAACT
TAACTAAGAAGCACTGGCAGAGCCTACAACAGGCGGAGGCTGCGCACCATACAAAGCGCCTGTCACGGTCATCGATTGGCGGCGGCGGGCTCAAAAAGAG
GGCTTTTTACGGATCTTTTTACGACATGTAGAAGTAATTACGCGTTTGTGTATGTGTACTCCATGTTTGCGTACCGTGAAATACGAGTTGTTGTCAGGTT
GGTTTCCGACAcacttgatttcagtatgAAAAGGTCTTTTTCGAGTCGGAAAAACGCCATTCTCAACTGCCCTATAGACTACTATTGAGATCATACCGTA
TTGTaggcgaagaaggtgatggcgAACCAGGAATGCCACATCTGTCTGGAGGAGCTACGCCGTGACCTGGTGGCTGCTCCGTGCGGCCATGTCTTCCACC
ACGTCTGTATCATCCAAGCCCTGCAAGTCAATACCCAGTGCCCCATTTGCCGCAGTCGTACGGGAGAAACCGACCTAATTACGCTTTATTTCGATGTCCC
GACTAATGAGATGCCAGAAGGAGGTCTACAGCTTCCCAAGGCGACCGGAGACAACGTGGCGCTTAGTTCGCGCATCAACACGCTCATGGAGCGCATCCAA
TGgcagaacaagcagcaggagcgccTTGTAGACGAGCTAAGGCGTCTTCGCAGTCAGAGTGAGCAGCTATTGGCTGATAAACAGACACTGGCACAGCGTG
TGGGGGGTCTGCAGGCCGGGAGGAATGAGCTATTGAACAAAGTGGCGAGATACCAGTCGGAACTGTCACGTCAAACGGAAGCTGTGCGGAAATCCAACGT
GAACCAGAGCATCATTAATTTTCTAGACACTTGTGATGCTtctgcgctggaggaggagatccagaaTCCCCGAGAACTTATTatggcgctcaagaaggcg
tGCAAGTTCCGACATGACCAGTATCAaaaggtggtgaaggagaagacgcggCTCAAAGAGATGCTGAGCAGTAAACAGTCACAAACTGCGCAACACTCGG
GAAGCAATACTAGAATGGCAAAGAGCAAGGCTCGGAGTTCAGGACCCGCTTCATTAGAAGGGAAACGTGCCTACCCAAGTTTTGGAACGGGGCTTCAGCC
GCCTGTAGAGACCAAGAAGCGTAAAATCGAGTCGTCGGCTATGCCATCGAGCGAGATGGTTTTCTTTGATCAAGACAGCGACGGTGGCTTGGGATTCACG
CCTTGCTCAGAGTCGGCTGGGTTCCGTTCGAATGCCTACTCGGACGTGTCAGTCCGCCCACCACCGAGTGCAAGGCAGACATTTGGACGCAGTACCTACA
ACCCAAACCAGTACGGGGCCTTCAACATGACACCGACGAGCCAGCCTCCTGTGCAAATGGTGGGATCCCAGGCCGCAGTGTGCCGCCGCGGGTATGACGA
AACTGGTAAGTTGACTAACTTTTTCCTCCCAAAAGAAGGCGATTCGCGGTCGATACCTCGGAAGAAGCCAATTCCGAGCATGCTGAACCTGCTGAGCTCA
CAACCAAGAAGTTCGGGCCAGCAACGCGTTGGCGACAACGAGCGTCAGGAGTACGCACTAACGAACTGGCTGCGCCATAATTGAGAGTGCTATGGGAAAA
CGGTGTAAGGCACGTAGATCGCTATTGACTCGGGAAGTCTCAGCCAGGACACTGTGTAAAATACTATTTGCAATGGTAGAGGCTGGCACGGCTTATCGTG
CTAGCTTTAAGTTTAAACAAGAAAGGCATACTTTGCTCGATAATTATTGGATCGTGCTACTCCTGGAAGCCGTGGAGCTGAGATCGAAGATACACCATCG
TTTCAGACAGAGCTAAGTGATGTTCTTTCACAGCTTGGATGACCTGAACATCGCTACAGGGGAAGATCCTGTCGGATATGAGACGATGTCCCAATTTCTT
CGATGAAGAGAAACGAAATATCCGCAGGGTGCTCGTCCTCCCTTTCCGATGGAATAGTTGCTGGATTAGGATCGCTAGAATCTGGGCTGTCATCACTTGT
ATTTATTTGGCTGTGAGATTACTGGTGCCAGCACTTTCGAACGTCGCCTCTCTAGAAACGAAGCCTCTGGACGCtccgctggtggtggcaatGGCGATAG
TTGCCTGCAGACACAGTAGCACAACGTCGCTAAGCTGGCCAAATTTGCTGGTGTCTGTTTTCCAATGTTTTTAGATCCGATGCTACGTTCCATGGCTGCA
AGATGATGTGTGGAATCAGAATCTGCACAAACAGGAAATTTATCATAAGTTATGATAAATTTCCTGTTTGTGCAGATTCTATGATTCATAACCATGTTGG
ACCGAGAGAAACATTTGGCATCTTGTGTACCCGCTTCATCACTCCTATCCTTCACACCAGCTAGGATAGGTCCTCCAACGTCCATTCTCCGAGCTGCACC
GAGAGAAATGGATTCTAGATTTCGGCGTTCCTCATTAAACAATTGGTACTGTTTAAAACGCCATCGGTAGAAATCCTTTTCAAGAAGTCCAAAATACCTC
TTTCTTGTCAATAGCCTTGTTTAGAGCCTGTAGAATTATTTCATACGAACTTTCAGCTTAAGTAGCTTCGCTGGATCCACGGAACTCTCACTTGGTTGGA
CATTAGGACGGCTACCGCCGGATTTCTTAGCAAAACATCGTGGAGATGACCCGGCAAGACCTCTTTTAGTGCTCATATCTAAGTCCAAATTTGAATCTTT
AAGGAGAGACAACAGCGCAGTCTTCACCACCTTTCCTAGCCACAAGCGAGTGGCATCAAAGTAAACACGCAACATGGACTCAACGTCCTACAGATTCATG
CGGCTAGTTAGTACTTCAACTAAAGCACATGTAGAAGTGTACgagataaaaaaaaaactcgcAAATACACAAACGTACCCACGTCGTGCTTTCCTTTTCT