Description :
From Genome Similarity Track
Location :
contig_21:133757- 135262
Transcript NameFunction/comments
g3843.t1hypothetical protein

Sequence
1505 bases(100 bases per row)
AGGTGTCGAGAAGCTTCGTGATGAGGCGCTTGGCTCTATCGTGGAGGAGTACGGCTGTCTGGGTCTCGCGTTTGTGCTGATTACATTGATGCTTTTACAT
TTTATCGAGTGCGAGAGTGTCGTATTTTTTGGAAGCCAGGGCTCGACGCTGCATGGTCACGGCCACAGCCATGGACAGTCAAATGATCACGCTAACGGGC
ACGAGTCCGACGACAGTGTCCGAGACCCAACCAGTACTCGGAGTGTTGATTTCCATGCTCTTCAGCCCACCGACAGCCCGACACCAGGCAAAGCGAACGA
TCACGGCCCCAACGTCCAGCGCAAAATCGCCACCATCATCTTCGAAGCTGGAGTCATCTTCCACTCTGTCATCGTCGGACTCGACCTTGGCGTTACCACT
GGAACCGAGTTCAAGACGCTGCTCATTGCACTCTGCTTTCACCAATTCTTCGAGGGCGTCGCCATCGGTAGCGCTGCACTCGCCTCTATCAAGAGCCGGA
ATAAATTGTTCATGATCAACCTGGCCTTCGCCATCACGACACCCATTGGCCAAGTCATTGGCATCGGTATCCGCAACTCGTATTCGAGTGAATCGACGAC
TGCTTTGTGGGTTCAGGGTGTCTTCGATTGTGTTGCCGGTGGGATTTTGCTGTACACTGGTTTGGTTGAGCTGCTGACGTACAACATGACCACGAACCAG
AAGTTTTTGACACGCAGTACATCACAGCGCTTCACGTTGTACATTAGCTTGTGGATGGGCGCTGCGCTCATGGCCCTCATAGGCAGGTGGGCTTAACTGC
GCTGCCTGGTATAACGCGCATGCTGGCGGAGATTTGCTTGGTTTGCGATCTAAGGAAGGAATAAGTTGTATGAATTTGGGACAATCGCTGTTCATGGTTA
ATTTTGCTCGAAAGCAATGCAAATCATCATGGTTCAAGAAACCTTGACAAATCTCATCATCAGCCATTCTTGCATTTTTGCTGTTCTGCATTGCACATGA
GATGTTTTAGCAAGGAACACCAGGTAAGAGGCCTGAATTTTTACCATGCTACTGTAGTACTTCGAAGTATTATACTAATTGAAAAGGTAAGCTTATCCGC
CCAAAAGTTGATATAGGTTTAGCGAGAGCCACATACAAATTACAAAATACCTGTTGCAACGGGTAAATTTACTTGAAAATAATACTTGGAGAGCGAAATG
TGTGCCCCCGAACTTTGCACGTAGTAACACTTCTTGTGGTGCCATTCGCGAAACTTGAATAATGCTGCTCACGTGGTATTTTTTGGAAGCCAGGGCTCGA
CGCTGCCTGGTCACGGCCACAGCCATGGACAGTCAAATGATCACGCTAACGGGCACGAGTCCGACGACAGTGTCCGAGACCCAACCAGTACTCGGAGTGT
TGATTTCCATGCTCTTCAGCCCACCGACAGCCCGACACCAGGTAAAGCGAACGATCACGGCCCCAACGTCCAGCGCAAAATCGCCACCATCATCTTCGAA
GCTGG