Description :
From Genome Similarity Track
Location :
Scaffold_12:133659- 135777
Sequence
2118 bases(100 bases per row)
AAGTAGGCTAAATGCTTTGTTGATCTCGTATTCCATGTCAAGGTCCAACGGAAGGACAAAGCTGGATAGTGTGTAAGTGATGCCGTCCCTTAGGAATTTC
CTCACATTGTAGTAAGTTAACGAAATCGCGGTTCCTAATCAAGAACGAACACATGTCGATGTTGTGATCGGCTAGGGTCGTGCGCTGCGCTTTAGCCATG
TTTCCGGAAACACGCCGCACGGACTCTCTAGGTGTGCTGTCGCTCGAACGCTCAACACCAACAGGATCCTCAAGCCATCTGTCCAACTCCTCTTCAGCTT
GTCGATCGCGGTGGGTAACGGTCGGTAGTCTCACTGGCTTGGAAGCGAATTCTCCTTCTAATCTACTCAATCGCGCGACGGAAGACACGGGAGGAGTTTC
TGTGTTGTCGACAGGCTCAATAAACATCGAGAGCAGCTCAAGTACTTTGCTTCGAACCTTTGTGTTCACGGCGTTCTTTTTCTCAACAGCTTCTTTCCCA
CTATTACCGTGCTATCGGCACGATGAAATAACAACTCGATCGAGGCGTTTATGTGTTCGCTTGTAGATTGGGTGAAACTTTAGTTACATCTCTAAAATGA
AAGAGCATTTTGCAAAATTGCTATCCTTGTCGTATCTGCTAAAAACTCGTTCGTCCAATGCTTCTCGCAGGAGGAGCCGTGTGTTTGTTGCAAGAGGGGT
AAGATCACTTGCAGCAATCCACTTAGGATTCTCATCACTCGACAGGTAGTTTGGCAGAGGCTGGTCGGGGTTGAGGTCTTGAATGCGAGCCAAAAAGAGT
TTCACCAGAACTTCAACCTTGCACAGGACGCTCTGCCTGACATGTGCATTTTACCTCTCCAATTTGCTTGAGTACAGAGAGGACGTGCACTAAATCATCG
TGGTGGTTGCCAGTGGGAACTCGGTAGGTGTCTTGTTAACGCGAAGCTCATGCTATTTTCGCTCTTCGTACCACGCTGTAATCACTGGCCATTTCAAAAG
TATTCACTCCATTGCGTTTGTCAAGCTCAGGAAGCGTGACGTCGAGTATCCAATAAGACGAGTTAAGGCTCTGTCTTAGACTTACACAGCCCCTCAAATA
AATTGCCCATTGTAGAAACATGCTTAATTTGGAATATAGTCCTCGCAAGTTTTGATATCAAGTTAGCCATAGCAGGATTCGCCTCAGCGCTCGCTGTACC
ATTCACACCACACGATGCTTTCGTAGCCGCATGAGCCATGTGGGCGCAGCACCACTCCCAGTGCAAGTCTAACTCCGTGCGCAGCATCGCCTTTACGTCC
CGCGATAGTGACGCCGAAAAAAATGCATTTCTTCAGGCCAAAATCCTTAAACATGTGCTCCAGCCATGCTTTAAACGGCCCCAAAATACCGCCTTCTCGA
TCACCGTACGCTGGGTTGAACTTTATTGTCCCCAACAATACAGACTTAAATTGCCACGCCTTGTCCACAAGGTAGACTCGCAACCCCACAAACTTATCTC
CGGTAGTCTTACATGTCCAGAAGTCCGCGACTAGCGTAAAATTGGATTCCTTATTTTCCTCAAGAAATTTATTACCTCATTTCTTGTCGACGTGTATAGC
TCAACAATCAGCTCCACGACGATCTTCGCGTTGAGTGTGGCCTTCATCGCATCCTTGACTAGTAGTGCTTGCATGAGTCTGGACTCCTCGTACTCCCCCA
ATCAAAACGGCAGATTATTCTTGATTATCGGGAGTGTCTGAAGAAGTAAGTTTAGTCGAGATGGGTTTCTAAACTGACGACTGCAAGTGCTCGATGTCTA
CATCACGCTTGCGCTTGGTTGCAAGTGTTGATTCTGTTTTGGAGAGGTGATGTTTTGTAGACGCAGAAGGTGTTTCGACGCAATCGTCGTCTTTCCAGCG
TGTAGCTTGATTAAATTTCGCCCGGATGTCCGACAACCCTCATCAGCTAAGCACACCCACGCGAGTACACTTTTTCCATTCTCGATATTTTTGACTCTTA
CACCCCACTTGAAAATGAACAAAGTCTCGGTAGGACGCGGTGGAACAACCCTGAATGGACCACGAGCTTGAAAGCTCTCCACCGCTTGTCGAACAGAGGT
AGGGCGTCTACCATTGTC