Description :
From Genome Similarity Track
Location :
Scaffold_284:13365- 16595
Sequence
3230 bases(100 bases per row)
CGAAGTGGTTGACGAGTTCCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCATTCGGATACTTCCAGTGGGTACG
CATGCCATTTGGACTCAAGAATGCTCCACTTGTGTATCAGGCGGTGATCAACAACTGCCTTTGGCGTTTCGGGCGTCTCCCTCGGGAAGGGGAAGAGCAG
GTGGACCCGGATGTACTCGAGTTCCTCGGTTTGGACCCGTCCGTTCGGGATGAATCCGAACGGGAGAAGGCTGGAGCTAGTGTTCCCGTCCTGGTGGAGC
AGATGACTGTGGTCCAACGCAACATCCCGATGCCGTCCCAGCTGGGACCTGGCCTCGGACGGAGTTCCTACATCGATGACATTGCGCATGGGGCGCCCAC
CTGGGATCAGTTGTGTGAGGACCTGAATGCGCTGCTATCCCGGTTGCGCTATTGGAACATCTCTGTCAGCCTGCCCAAGAGTGAGTTCGGGAAGTTGAGT
ATGTCGTATCTCTCCCACGAGATCAGTGCCGAAGGACTGCGCGCGACTCCGAAGAACGCGAAGGGCGTTCAGGATTTACCGTTCCCGTCCACCCTGAAGG
GAGTCCAATCATTCCTCGGAAGCCTCAACTACTATCACAAGTTCATTGAGGATTTCCCGGTTGTGGCCGCAGTCCTGTATGAGCTTACGGATGATCAAGC
GAAGACCGACCGGGATCTGTCAAGGGCAAAGGAGGCATTCGAGATCCTTAAACGGAAGATTGTGTCGACACCCCTGTTGCGACACCCCGACCGGGCCAAG
CCGTTCGTGATTATCCCACATGCGAATCGCTGGGCCGCCTGTGCGGTCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCACCGGTGATCAGTGTGGAGATGCTGGAGGCTAATTTCGCTGGATACGTCCTGAGTTTCGACGGAGCTGCGAAGACATCGACGAGGCGAGGAAGTTGTG
GATATACCATCTGGGAGCTCCCCGACTGGAAAGTCCTGGCCGCGTGGGGTTTCATCCTGGATGATGTTACGGTGAATGACGCTGAGTAACTCGGCCTCCT
GAATGGGTTGAAGATGATCTACGATCGGGGTATCCCGGATGTGGTTGTCGTCGGAGACTCTCGGATCGTCATCCAACAGGCTCAGGGACTGATTAACTGC
AACCAGCCAAACCTGCAGCGACGTCTGGCCGAGTACGAGGTGATGAAGCAAACGTTCACCTCGATCCGGCTGGTACATGTCAAGCGGGAGTACAATCAGG
CTGCAGACTACTTGACGTCCAAGACACTGGCGCTCGGAGAATCCTGTTCGATTGACGACCCGGATGAGATGGAACATCTGGGGCGAGTCTCTCGGATCCC
CGAACAGATCATGAAGCCTGAAGTGGGCCCGAGCGACGATTCCCCCGGTGAGCCCAGTCAGGAACCTACGACTGGGGCGCCCGACGATGCAGGTCCCGGG
CCGGAGTCAGCCCCCTGCCAATGGCAGCCAGGGTCATGGCTGCGATAACTCGTAGCCAGAGCCGTGAGGACTCCAATCACGGCGAGTCTACGAACCCGCT
TGAGTATCAGGTTGAGAGGTGGCGCCGAATCAAGGTGCACCAGGACGCTGATCCCGAGTTGATGAATCTGAAGAAGTTCCTCAAGGGCGACCTGGATGAC
TTCTCCCGGCTGGAGATTCGCAAGCTGTCCAAGCGGGCGGACCTATTTGCGTTGAACGTTCGGGATGTGCTCTATCGACTGGTCAGGTCTAATCGGGACC
AGCCTCGCGACAAGACCGACGAGTTGCGCCTACTCGTACCAGAAGTACTCTGTCTGGACATGCTGCATTACGCCCATGAGGATTTCCAAGGTGGCCACCA
ACGAATAACCCGGACGCACGAGAAACTCCGGCTGGAGTTCTACTGGCCAGGGATGTACGCAGATGTTGAAAGATACGTCAAGGAGTGCACCGACTGTGCC
AGCGGCAAGGAGCGTCCGCCCAACCCTGGACCTTCGCCCGGGGACATCGAGCCCAGAGATCCTTTCGAAGTGGTCTCGATGGACTTCGTGACCCACTTGC
CGAAGTCCGAACGGGGCAACACGTTCTTGCTCCTGTTCCAGGATGCGTTTTCGGGTTTCGTGATGTGCAAACCGATGAGTTCTACCACCGCTCAGGATGT
CGCTGAGGCATATGAGGAGAGGGTGTTCCGCTGCTTCGGAGCCAGCTCCCTATTGCGTCATGATCAGAATCCCAGGTTCATGAGTGAATCACTCGGTTCA
GGGAACTTCTAGGTAGCCGATAGCGAGCTACGTTGGGGTACCGACCCCAGACGAATGGACAGCAGGAACGTTCCGTCCAGACTGTGGTGAGGTCCATCCG
GGCTTACAACGCAGAAGCTGACCAGAGCGACTGGGATGACCACGCAGAGAGGCTCATGTTCGCGCTCAATACGTCGTTTGATGCAACCCGGCTGGACACC
CAATTCTACCTGGTCCACAGCTGGGACGCCAAGAGTACGATCTCAGCTATGCTGGGGCCTAAACCCTCCAGTGTCCCCGAACGGACCGCGTATGAGTGGC
GATGGAAACTCCAGCGGCACTACGGCTACGCTCGGGCATGTGCAGAAGGCCTCCAGAGGAAGGCCAAACGGGCTCGCTCGGAAGAGCAAACCCGGAAGTG
GAACGAGTTGTCAGACCGGCTCAAGGCAGGTTTCAACGTTGGGGATGCAGTCTGGCTGTACATCCCAAAAGTGCAACCGGGTCTGAGTCGCAAGTTGGCC
CACTTGTGGCATGGTCCATTCAGGATCGCCGAAGTGGTTGACGAGTTCCGGGTGAGGCTCAAGGTTAAGGACACGGGTTACCGTGTAAACCCTTGGGTTC
ACATCAGTCGACTGAAACCCCGGGCGTTGTATCCCAGACGGCCTATAATCCAACCGGAGATCGAAGACAACGATGACTTTGACACAGCACTTCTTCCCGA
AGACAGCTGGGAGGCGGACAACGAGAATGACGAGTACGAAGTGGAGAAGATCATGGATCTCAGGTGGAACAAGCGTACGCGGACGTCCAAACGGGCACGA
GAGTATCTCATCAAATGGGAGGGGTACGATGAGCCTGACTGGATACCGATGGCACAGCTGAATTGCGGAGCGCTCTTGTATGAGTTCAATCAAGGGACAT
GGTTGGGAGTGGTCAAGTCCGAATGGGGCG