Description :
From Genome Similarity Track
Location :
Scaffold_473:13365- 16124
Transcript NameFunction/comments
Phymu_g10207phospholipid-transporting ATPase, putative

Sequence
2759 bases(100 bases per row)
GTCTATTTTAACTACGCGCCGGGGAATGCGGTGTTCGACAAGTGCTCGAACGTCGTGGTGACGTCCAAGTACAACACCGTTACATTCCTGCCCAAGTTCT
TGAAGGAGAGTTTCACCAAGGTGgccaatttcttcttcctcatggTCTGTGTGCTGCAGAGCATCCCTAGCATCAGTAACACGTACGGCTACCCGACGAA
CGCTCCggtgctgttcttcgtcatctccatTGACGCCGTGTTCGCCGTCATGGAGGACTTGAGACGCCACAAATCCGACAACGAAGCCAACTCGGCCACG
TGCCACGTGATTCAGGACGGAGCGGTCGTTGACAGGAAGTGGGCAGACATCAAGGTCGGGGACTTCTTGCAGATCCGCAACAGAGAAGTGATCCCTGCGG
ACGTACTTGTCCTCGCTGTATCGGAACCTGTCGGCGAACCGCCCAGTGGTATTTGCTACGTCGAGACCAAGAGTCTGGATGGGGAAACCAACTTGAAGCT
GCGGCAGGCTGTCGCGGCGACCATGAACTCGCTCGCAAACGCAGCGGAGTTGGCGCTCTTGCGTGGTGTCATCAAATGCGAGCAGCCCAATCCACACATC
AACAAGTTCGCAGGGAAAGTGGAGGTCACTGTCGGTGACGGCTGCGGCGTGGAGGTGATGCCGCTGTCAgtcaagaacgtgctgctacGTGGCTGCAACT
TGCGTAACACGGACTGGATCTTCGGCATTGTGCTCAACACAGGTAACGACACGAAGATTATGCAGAGTGCCAGTGGTGCGCCGTCCAAGTGGAGCGACCT
GATGCTGAACATCAACCGCATGATCGTCATTTTGTGCTTGGGGCTGTTCGTGGCTTGCGCTATGGCCGCTACCTGTTACATCACGTGGCAGTACGACATC
GTGCGCAACACGTGGTACATTGAGCTCTCGGAGGCGGAGAGGAACCGTTCACGCTTCGTGGCCTTCATCCAGATGATGTTCTACtacttcttgctgctct
aCCAGGTCATCCCCATCTCTCTTTACGTGTCCATGACGAGTgtcaagttcctgcagtcgcGCTTCATGTCGTGGGATCTCGAGATGTACCATGCTGAGAC
GGACACCCCTGCTATTGTGCGAACGATGGAGCTTAACGAAGAGCTGGGCCAGATCTCCTACGTTTTCAGTGACAAGACGGGAACGCTTACGTGCAACATC
ATGGAGTTCCGCAAGTGCTCAATCAATGGCACTTCTTATGGCTCGGGTATCACGGAAATCGGTCGTGCTGCCTTGGTTCGTGCTGGAAAACCAATCCCCC
CGGAGCCTAAGCTGGACCCGAGCATCAAGAGGATTCCGTTTGTGAATTTCGTGGATAAGGCGCTGTTCGACGGTATGAAGGGCAGTGCTGGTGAGGAGCA
AAAGATGAAGATTATGCAATTCTTCGAGCACCTTGCCGTGTGCCACACAGTGATCCCTGAGAAGTTGGAGTCTGGAGAAGTTCGCTTGTCGGCATCGTCT
CCAGATGAGCAAGCACTTGTGGCTGGTGCAGCCTTTGCTGGATTCAAGTTTGAAAGCCGCAGTGTTGGAACAGCGATGGTGGAGGTCCTGGGACAGCGTG
TGACCTACGAAGTACTGGATGTCCTCGAGTTTAACAGTACGCGTAAGCGTATGTCTGTTGTGGTTCGCAAGCCAAccggagagctgctgctgtacacAAA
GGGAGCCGACATGATGATTTATCAGCGCTTGAAGGATGATCCTGCaatgcagaagctcaagaacatCACACGTGATCACATGGAAAAGTATGCTGACGAT
GGTTTACGTACATTAGCGCTTGCTATGAAACCACTGGATGAACGCTGGTTCCAGCAGTGGAAAATGCGCTTCGATGATGCACAGGGTAACGTGGCTGAGA
TCGACCGCCGTAAAGATGGCAAGCCAAACGCTATCGATGACCTCATGGAAGAAATCGAGGAAGGTCTGGAGCTCATTGGCGCGACAGCCATTGAAGACAA
GCTACAGGACGGCGTTCCGCAGTGTCTGGCTAACCTGACGCGCGCGGGTATCAAGGTGTGGATGCTCACGGGCGACAAAGAGGAAACGGCTATCAACATC
TCGTACGCTTGCTCGCTGCTCGACAACACCATCACCCAAGTCATTGTAAACGCGACCACATGTCCGGATGAAGCAGCTATCCGTGCCAAGCTAAATGCCG
CAGCCCGCGAGTTTATGGACAGTGCTAAGGGTAtggctggaggagcagaGAAGGAGATTTCGTTGATTATCGATGGCGAAGCTTTAGAGATGGCgcttcg
tccaggaactgcgCCTCACCTGCTGTCGTTTGCGAAATTGTGTCGTGCAGTGATCTGCAACCGCGTGTCGCCTGCACAGAAGGCCGAGATGGTGAAGCTC
GTCAGGGAAAATATCAAGACTGTGCGCACACTTGCTATCGGTGATGGTGCCAACGATGTCGCCATGATTCAGGCTGCTCACGTCGGAGTCGGTATCTCTG
GACAGGAAGGTATGCAGGCAGTGAATTCGAGCGACTACGCCATTGCGCAGTTCCGATTCCTAGAGAGATTGCTTCTAGTTCACGGACGTTGGAACTACAT
TCGTATCTCCAAACTTGTGCTCTACATGTTCTACAAGAACATCACGCTTGTGCTGGCGCAGTACTGGTACGGGTACCTCTCGGGCGCCTCGGGCTCCAAG
ATGTACTGGGAAATCGGTGTTCAGCTGTACAACGTGGCATTCACAGGTCTGCCTATCGT