Description :
From Genome Similarity Track
Location :
contig_204:13364- 14565
Transcript NameFunction/comments
g14758.t1RAW24142.1 hypothetical protein PC110_g19429, partial [Phytophthora cactorum

Sequence
1201 bases(100 bases per row)
AGCACGCGACTGCTCTCCAGTTCTTCGAATCGATACGCTTTCTCGTGCTCCGAGTACCCCAGGAACCGACAGCGCACCGACCGAGCGTCGAACTTGGTGC
GCTTCGCCTTCGGCACGTGCACATACGCGTGACAACCGAAAACTTTCAGGTTCGCCAGCAGCGGCTTCTTGCCAGTCCAAACTTGGTACGGAGACTTGTC
GTGGCTGACGGCGCGTGTCGGACACCGATTACGGAGGAACGTAGCCGTCATCACCGCTTCGCCCCAATACGTCTTGGACAATCCGGCATGTTCCAGCATG
CAGCGCGCACACTCCACCAACGTCCGGTTCATCCGCTCGGCGACTCCGTTCAGCTGAGGCGTGTACGGCGGAGTGAACTTCTGCACGATACCGCGGTCCG
CACAGAACTTGGCCATCGCGCCGGAAGTGTACTCGCCACCGTTGTCGCTCCGGAGTGTCTGCACGCGCTTGCCGGTCTGAGTTTCAGCAAACGCCACAAA
CTCCGCGAACTTGGCAGCCACCTCGGACTTGTTCCTCAGCAAATACACCACACAGAAGTGCGACTTGTCGTCGATGAACGTGACGAAGTAGCGCTTGCCC
CAAACGTTGGCGTCTGCATGGGGCCGCACACATCGCTGTGAACCACCTCCAGCACGTGCTTCGCGCGGTTCGGGGACGACTTCATGTAGCTCACTCGCGT
TTGCTTGCCGAGTGCACACCCGTCGCACAGCTCCCACTGCTTCACCGACGTCATGTCGATGCCAACACCGTAGCTCTTCTTGACGATGGCGTCTAGACCG
CCATGGCCAATGTGACCAAGTCGGAGGTGCCAGAGGTACGACGTGGTGTCCCCTTGGCGATCCTTCGAACTTGCCGCATTGGCCTCGTCAGGCATCATCG
GAGTCATGCACAGCTTGAACAGCCCTTTGCCCTCACGAGCGCCGAGCTGCCACTTGAGACCCTTGTTGTCCGCGAAGCACCCGTCGCTCTCGAAGGTCAC
TGGCCCGACGTCCTTGGTGAAACGGCCGACCGAAAACAGGTTGCGCGACAGTTTCGGGATATGCCACACATTCGTGAGCACACCCTTCTTCATGCCGCGC
GGCGTCTTCATCGACATGACAATGTCGCCGGTCCCCACCGCCTGAACCACACCGTCGTCCGCGAGATGCACGTCCACCGGAGCCATCTTCTTGTAGTTCC
G