Description :
From Genome Similarity Track
Location :
Scaffold_79:133625- 137605
Transcript NameFunction/comments
Physo_139849hypothetical protein
Physo_139850hypothetical protein
Physo_139851hypothetical protein

Sequence
3980 bases(100 bases per row)
CCGTCGCGATAGCGTGCACGTGCTGTCGGACTTGGTGCTGCAGACCAACCACCCGAGCGTGACGGTGCAGTCGTATGCCACATCTACTACTTCCTCGCAG
CCCGAAGTCGTACCGAAGCAGCCTCAGGACCCAGAAGAGAGCAGTGAGCCCGAGCTGGACTCCGCATCGTGCCGAACACAAGGTAGCTCTTTACTCAAGG
GCGAAGCGCAATTCCTGTACGGATGAGGAGCGACAGCAAGATCGCCGAGCTGCCACGGTTCCATTTTGGAAGGTGGGAGACTCCATCTGAAGACATCTAC
CGACCCGCCAGGTCGACTCCATCACCAGCGTCCGAACCTGCATCTCTCTGTGTACATTGTTCATGTTGAAGTGAGGAACAACATCGCTACGTTGATCATT
TGCCCGCGTGAGCAACACACACACAAGTCAGGTTTCGGATGTTTGCTCACGCCTAAAGAGCTCTAGATGCTGTGCTAGACTTGAAAACCCAAGAAGTGTT
GCGTTTTACTACTGTAGTTACCAGACGAGCGGGTCAGTAGATGTCGAGAGAGCACAGCGGGGTTATTGGAGGGTTCTTTCGCGCGCGCCTCGTTGGTATT
ATACCAGCGAAAGAAACATTTTTCTGTGTGTACGTATGAATAGTACGACGTTGAAGTGTGCTGTAAGCAACGACAAGTTATCTGGCCCCACGTTCCTCCG
CGCAACGTGGCGTTGTTTATAGTCCTCCGTGAAGCCGACATAAGGGGGTTTCCGCATGCGATAGCGCGTGCAGTCCAGCAGGCTGCGGCACGAAACACCC
AGCGCGCGTTACGCAGCAACCTTGATTTTGAGCCAAGCTCGCGCTTGCTCGACATGACATTGCGTGGAAAGCCGCCGGGCGACGCTTGGGTACGTCGCCT
CTGGAGATTCTCGCGCCGGTCCGCCGCCGTCACTCTCGTATTCCCCTCGCGCGCAGAAGCCGAGTCTTTCTCCGTCGTTTGGGAGAACCTACGCCGAGGC
CACACACGACGCGTACACAACACCAAAGCTAGCAGCAGCAGCAGCACCGACAAAGCATGCTCCCGGACCCTGGACACTCGCAGCCGGCGTCGCCGTTCCC
GCGCCAAAGCCTGAGCGGCTGGAAGGAGGAGAGCGCCGACGTGGCCACGCTCTTCTTCCCTGCCAACTTCCTGGAGCCCGCGACGCCCGAGACGTTCCTG
GAGCTGGACCCCGCGGGCTTTTTCAGCAACAGCAACAGCAGCAGCAGCAGCAGTAGCGGTGCGACCAAAGGAAGTTGCACCGCTGCCAGTCGGCGGACGC
CCCCCTCTCAGCTCGGCTTCAACTGCTGGTCCAAGCTCGAGCCGTCGCGCGAGCCGTGCACCGACGAGATCCCGTGGCCGGACCTGGTCTTCTGGCTGGG
CAACGCGTCGACCGGCGAGGTGGTGTGCTCGTGCGCGCAGTGCGCTCGGCGCGCCATGCGTTGCAGCAGCGGGCACCGCTACTCGCCGTATCCGCAACAA
CAACAACAACAACAACAGCAGCAGCAACAACGGCGAGTGTCGTCGCGAGTGCCAGTGATCAACCTGCCGCGCATCGAGGGCGTCAACTGATGTGCCATAC
CGTAGTCCGTTTATAAGTTAAAATGCCCCGCGCTCCACGCGCGCGGTTTTTGAATGCCAGAAGTCTGCCGAGTTCGAGTTCTCTTTGCCTTCAAGCAGAG
CTTGGACGTCCAACTTCAAGCTCCAAGCTTTTGCTTTTGCGTGACGAGAGGCAAGCTTTTGATGCGTCATACATGTACATGTAGGACGCCTACGTGTCCG
GTTCGGTACCGCACACTGCTTGCTAAACTGCTTCAGTTGCCGAGTCTTCGCGGTCTCCGATGCGCAACCAGGGACACGATTGCACTGCAACGAGTGACGG
AGGGATAGGCGAGGGAATCGAGTCAGAAAAAGTTCAACTTCGACTTCGACGTGGAAGTTGGAACGGGTGGTGGGCACGCGCTCGCGAGAGACACACGTTG
AAGTCAGTTTTATTTGACAAGAGGAGGCTGCCTTCGCGCGCGCCGGCAGGGATCCGCTGCACCGTGCGGACGGCGTCCCGAGTCGCAGGCGGCCAGCTTT
TTTCAGAAACGTGAGTGGTGCAAGAGCAGGCTGTTGAAGTCGCTGACCCGCTTGCAGTCGCCGAGCGGCTGAAGGCAGAGAGACCTGCCCCATCGGATAC
CGAGACCGCGTTCCCGCACGCGCAGCTCCCTCAAAACGACCGACCGCGCGTCAAACCACCACTGCGGCAACAGCATCGGTTCATCCACGCCAACGGTGGC
GAACACGTGGCGGCGGGATCGGCCATCCCATCGTGCGCGCGCACGCTGATCGCGACCTCGTTTCTGGGCCTCAATCAAGTCCCATACAAGTTTCAGCACC
AAATTGGGTGGAGCCGAGCGCGCGTCACATGGGACCTCCATCGGCATGATACCTCGTTTATCCTGAAATTTTCTACTGAACGACGCACATTACCTGAGCA
GCTTGGCAGGAAACATACACGACGCAATCCAGCTCTACGCTAAAACTTGTTGTTACGTGTGGGAGCTAGGCTGGTGATATACTGTACTGTTCATTCACAG
ACGGCAATGCACTCCGGCCAAACAGCGCCATTTTCTTTTCCTTTAAATTACTCCACATCCCTCTTCATAGCGATACCCGGCGATCTCTAATAGTGTCCAC
AACATCGGTCATGACAGGTTTCTGCAGGATATGTCTCAAGAGGTCCGCTTCAACCAGGCGCAGCGCCGGGGCGCTCCCTCTCGCATATCTTCTTCAACAA
TCGAGGGATCGGTCCACTTCAAGATTCGCCCCTCAACGCGCGGCGGCGCAGCAGCAGCGCTGGGCCGACCGCATTTTCGGGCAGCGGCAGATGGCCGGCG
TCCGTGAGCCTCTGCGCGTTGGCCGAGCCCCGCATTCCGCTCGCAGGCGCCGCAGTCGTCGCCGTTTTTTGTTGAAGTTGCTTGGATCCAGAGCCGGGTC
GCTTTTGTTTCCCTGCCAATTGGCCAATCGCGCGCGATCTTTCACTTCAACACGATTCAAAATCGTCAATTGACGAGCGCTGCCGCATGATTGGCCGAAA
ACCGTCGCGTTGACGTGGAGGAGAAATACGTAGGACGCGTTTCCCAGCCGGTGGTGTGTGGCCACTTCGCCTTGAACTCGCACTCGCGATTCGGATCACT
CAGGCCCAGCCCAGAAGCGATAGACCAGACTAGACTACATACCACAGGCCCACCCATGGACATGCGCTCGCTCATCCACCAGGGCTCGTCCCCTAGCAGC
AGCAATGCGCCGCCCACCAGCACCAGCATCAGTAGCAGCAGCTCGGCCGCGCCCGTGGCCCCCAGCGCCGCGCCCAGCTTCCCGGTGTCCGCGCCGCTGC
CCGTGCCGTCCTTCCCGACGATGCGGCCGCAGCCCACCATCTTCCAGCGCCAGCCCGCGCCGGGCACCGTCCCGCAGGCGCCGACGCTCGCGCCGCTGCG
CTTCATCATCCCCAGCTCGCGCACCTCCAGCGGCTTCGGCGCGGGGCTCACGGCCCCCATGCCGCCGTCGTCCTCCGGCCAGCAGCCGCCCATCTACAGC
ACCAGCACCAGCCTCAACGAGCCGGAGCGCGAGCCGCAGCCGCAGCACTCCATGCTGTTCCCCCAGGACCGGTACACCATGAAGACCGAGCAGCAGCAGC
TGTCCCCCACCGCCGGAGGAGACCTGGATGACCAGAAGCAGCCCAAGAAGATCACGCCCAAGCGCGCGCGCACGCCCAAGATCTCCAACAGGTCCACGAA
GAGCAAGGCCCGGCCGGGTCTCCGCAAGGGCAAGTGGACCGAGGAGGAGAGCCGCTACGCCGCGCAGCTCACCAACTACTTCAAGGAGGGGCTTCTACCC
CTCGAGAGGGGCACCATGCTACGACTGTATCTCTCGCAGAAGCTCAACTGCGAGCCCATGCGCATCACCAAGAAGTTCAC