Description :
From Genome Similarity Track
Location :
scaffold_1568:1336- 3066
Transcript NameFunction/comments
Pl_100536hypothetical protein PHYSODRAFT_485789

Sequence
1730 bases(100 bases per row)
CACGCTTTCCACCCCAACCGCTAAAGGAACGGACACGTCGCCGACAATATACTCATACATTAACCGGATTTTGGACCGTGTTACTCCAGCCACTGGTGTT
AAAGAGATGTTGAGTTCGCATTCTTTCCGCCGCGGAGGGGCTCAGCACGCACGCTAACGGGTGTGACGAGTTGACCGAGCGCTGGATCTTTGACCGCGGA
TTGTGAAATATGAGCTCGGCAAATAAGGGGATCAACTCATATTCGACACGAGCAAAGAAGGTCACATGGTAGCCAAGGTTCTTGCAGGATACAAGCCGAA
ACAGGTCGTGGTACTCCAGTATATCAGCTGCTTCGACTCCCAGACAGTAAAACGAATTGACCACGTGTAGGAGATGCTCAATCTAGTGGGTCCAGCCGTC
ACTCGCATCGAAGCCTCGATTCGTATTAGTGGTAACTCGGCCGCTGATCTCCTGACGTAGTCTTCGCACCTCGCGCTTCCAGATAACGCTTGTAAGAGAA
AAAACACGGATACGATCACAAGCACCCCCAACCGTCACGCCAACGAACCAACCAAGGAACAGAAGATCGTCGATCATCAAGCTGCTGTCTTTAAGCACTT
AATTGACCACCCCAAGCACCAGGATGAGCGGATGAGCCGATAGACGCACTCGAGGCAAAAATGAACAACGACCCGGTCCCTACAAATAAGCGCAGCAACC
GCGAAAGCATACAATCAACGGACGTGCGCACTCCAAAGAAGAAGCAATGCAGAAGTGGGGTCACTCACCTTCATGCCACCTGGTTTGCTTGATACGCGCA
GGAGCCTCGCTGGTAGACGGGAGAATCCAAGAGACAGAGCTCGAAGGTCAAGCTCCTTGTGAACTTCATGAACATCTTCTTCTTGGGCTGTTCACGCTTG
ATCCTTGTGCTACCGGGTACCGCGACGGCGTGCTCGCCCTTGGAATGCACACGGAAGAGGAGGTGCTAGCCTTCTTCAGCAAGCACCAGATCTCGTCGCG
TGAGTCCAGCGCCGTCCTCAAGCATCTTCAGGCGCTCCACACGACCGGCGAGCTCAACAGCCACATCGAGCGTCATCAGCGTCTACTTCACTCCGTGGAA
ATCCGTGACCCAACGCCAGACTACACGCAAGAAATCCTCGAGCTAGCATAGTCTTCTTTAACTAGCTTGCACGGCAGCAAGAATAGATGTTAACCCTTCA
GCGATTAGAATACCACAACATACGGCACCGCTATCGCAGGCAGTGCACAGTCGAAACAGCACTTGGAGCAGCGAGCGGGACACACGGCCTCTTCCCCCAT
TCAGTCGCAAAGAGAGTAACTAAGCCGGAATCGAACCGGACTCCAGGACTACGTCCTGTGCTCTGCCACTGAGCTGCTTGGCCATTGGGGGATGAGCACG
CGGGCATGCTGTACTTTGGTATTTGGGGAGGGTGGTGGGGCTGGAGATCTGCGGGGTACAAGCTGAAAAAGTACGAGTGAGATCCCCAGAGCCCTATCGG
GACTCCCCCAGCTGCTGGTTTGACTTGTGGCAACCCACAACCACCCACAGCCAGCGTGTCTATCCATTGACAAGTATGATCAGAGAGATTGTGGACTGGT
TGTAATACTCACGTCACTGCGTCTTGACCTGGTGCCGCTTAAGGACCGATGAAAAAATTGTCGAGATGTTCTACAACAATGACAGCGGAAAGGTTGACGG
AAAAGCGCTCGAGAAGATGCTTGCATCAAC