Description :
From Genome Similarity Track
Location :
Scaffold_5:1336- 2762
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_5-fgenesh-gene-0.0Histidyl-tRNA synthetase

Sequence
1426 bases(100 bases per row)
GCAGCTGAAGGAGCGGGCGGCCGAGAGGCAGGTGAAGGCTCAGGAGGCTGCCGCCAAGGCTGCGGCTGCGGCCGCCAAGGAGGACGAGAAGCTGGCGGCA
ATGCCCGAGGCGCAGCGCAACAAGATCCTCGAGAAGCGTCGCAAGAAGCTCGAGAAGCAGAAGGAGAAGGAGAGCACGAAGAAGAGTGCCAAGGACGAGG
TGAAGATCGGACTCGGCAGCGCTGCGTTCCGTGAGTTCCTGAGCACCCGCAGCAACGCCCTGACTCCGTTCGACCTCCGTGTGGACGGCGCGGCGCAGTT
TGTGGAGGACTTGCTGCTCCGCCTGGGCAGCGGCGGTGCGCGTCGCAAGCCCAAGATCGCGAAGGGTGCGCAGGACTTCCTGCCGAACCAGATGCAGCTC
CGCGAGAAGATCTTCAACAAGATCCGTATGGTGTTCAAGCGCCACGCGGGTGTCGAGATCGAGACACCGGTGTTCGAGCTGAAGGAGACGCTGACTGGCA
AGTACGGCGAGGACAGCAAGCTCATCTACGATCTGGCCGACCAGGGTGGCGAGCTGCTGGCGCTCCGGTACGACCTGACGGTGCCGTTCGCGCGCTTCAT
GGCCCTCCATAACCCTGGCAACATCAAGCGCTTCCACATCGCTCGCGTGTACCGGCGCGACAACCCGCAGATGGCGCGCGGCCGCTTCCGCGAGTTCTAC
CAGTGCGACTTCGACGTGGCGGGGACGTACGCGCCTATGCTCCCCGACGCCGAGGTGCTGTCGATCGCCATCGAGGTGCTGCAGCAGTTCCCGGAGGTCG
GTCCCTTCAAGGTCAAGCTGAGTCACCGCCGACTGCTCGACGCGATCCTCGCCATCTGCGGCGTGCCGGCGGACAAGTTCCGCACGACGTGCAGCGCGAT
CGACAAGCTGGACAAGGAGCCGTGGGAGAACGTGCGTCGCGAGATGGTGGACGACAAGGGTCTGCCTGAGGCTGTGGCGGACCGCATTCAGAAGTACGTG
TGCAAGGTTGGGTCACCGCGCGAGCTCCACGAGGAGCTGGTTCGCGAGAACCTGTTCGGCGACAACCAGGACGCACAGACGGCCATGTCGGACCTGAAGC
TGCTGTTCGAGTACCTCGACGCTATGGGTGTGCTGCCGTACATCTCGTTCGACCTGAGTCTCGCTCGCGGTCTCGACTACTACACGGGTCTCATTTACGA
GTTCGTGCTGACGAGCCCCGAGCACAACGTCGGTTCAATCGCGGCGGGCGGTCGCTACGACAACCTCGTGGGGATGTTTTCGGCCACGGGCCAGCAGATC
CCGTGCGTCGGAGTGAGCATGGGCATTGAGCGTATCTTCAGCATCCTGCAGGCGCATGCCGAGAAGACTGGCGCGCTCGCTGTGCCGCCGTCGCAGGTGC
TTGTGGCGTCGACGGGCACAGCGCCA