Description :
From Genome Similarity Track
Location :
scaffold_12:133552- 145578
Transcript NameFunction/comments
g775.t1 hypothetical protein PHYSODRAFT_468503
g776.t1hypothetical protein
g777.t1hypothetical protein

Sequence
12026 bases(100 bases per row)
CAGTTCCGTTACGCTCTTTGTTGTACTAGGCCTTACACTCTTTACAGTTCTGGCTGTAGTAGGCGGTGTGCTGGTCCTGCGACGATGGAAGAAAACGGCA
GCACAGGAGCAACATGATTCGCTAGTGTCTGCCGATGGGAAAATTAAAGCTAACCTGAAAAGCCTAAGAGCGCGAATGGGAGGAAACGGTACTTCAGTGC
AGACTACGGAGCTCGAGACGTCATTGAACGAGTACAACACTGGCGGTGGACTGCGCAAAGCTGCTTTCAAGGAAATTCCAGCCACAGACATGGTGATGCT
AAACCAATTGTCAACCTCTGGCCCAGTGGTGGTGGCGCTTGCTGAGCATCGTACAAAGCTGGTGCTCGTGACACAGCTTCAGCCCAGTGACGATGATGTG
GAAGCCGCTTTGGATATGGTCCCGACGCTTTCTCAAATGCGCCACCCACAGTTGCTTACGATTACTGGACTCGTTTGGGATGAGAGGCACGCGATGACTG
CTGTGTGTGAATACATGACACTGGGCACCCTAGAAGCGTATCTCCGGAGTGCTGGATCTGAGCTCAACTGGAAGAACTTCAAGATGAAAGCTGCAGCGGA
GATCGCGCGAGGACTCATGTACCTGCACAGCCAGCACATGGTCACGTATGACGGGCTGAACGGCAGAAATGTGTTTGTCGACCCAACCAAGGGCTGCAAG
TTGAACCCGATTCAAGCTGCGCTCCCTACGGATGGCTCGTCACCCTACAGTTGCCACTCCTACTACCAGCGTTGCGATTCCACTACCAAGGCTTTCTTCG
CTCCTGAAATTTTGATTGGCGAGCCTTCCCGGTCGTCCTCGGACATGTACGCGTTCGGTGTGCTGCTTGCCCACTTGGATACGTGCCAGACAGCGGATGA
AATGATTAGAAGCTCCTGGAGAATGCGTACTCACATCGGCGATTTTGATTCGGACAACAGCACAGTTTTATCTACCGATGGAACAGTTGTGTCATCTAAT
ACGCCCGACTCGGACAGTTCGCGACGGCGCACCACCCAGCTTGAAAGCCTGCCGAGTAGCAACGGTGCGCGTATTATTCAAAGCTCTCGAAGCCTCGCTC
TGGAGGAGAACCGACGACGAACTACGCCGGTTCTGGGAGCCCACAACAATGACGAGACCAGTTTTATGGGGATGTTCACTTTCACCCCGGAATGCCCCAC
GATGGTGCGGGAGCTGGCAGGCGCGTGTCTTCAATATGACCCATCGCTACGTCCTAGTGCATCCTACATCGCCGCCATGCTGCACATATAGAGATAGTAT
ACACAACCAACGAAAAAAGTATAATAGCTCTTTGAAAGATTTAAACTGGTGCTTGAGATTGAAAGCGGGACGTGGCACACGTGTTTCTTCTCTTTCTCCT
GGAAATCGTTCTTTTCTGCTGTCTACTCCCATCAAAGTGATGGTACATTGTATTGTCTTGACTCGCAAACGTTGGGATCACTTTCAAAATGGCGCTGTAT
CGAGCTCAGTATCCTGTATCGACTTCTGCTTCAAATGTGCGTTCAAACTCACGCCCTGACGCTACTGACAATGGTGAAATGGCTAGCGACTGTGCTATTT
GCCTCGAAAGTTTGCAGAAAAGCTTAGCTGCTCTGCGATGTGGGCACGTTTTCCATCACTCCTGCGTGGAGGAAGCTCTTGCGCTCCGTCATGCTTGTCC
AGTGTGCAGGCGCAAAGCTGGCCCGAACAGCGCTGTTCGACTGTATCTGTCCGTCGGAGGAGCAGTAGACAATGGCGCATCAAACTGCGGAGCTTCTTCG
TCTTGCACAACCTGCAATGAATCAACTACTGCTACTGCATCGCGGCTACCTGAGCGTATGAACGAGATGAGGAGAGAGCTGGAGCGCATGTACCAGATTC
AGCGAATGACGTCGAGCCACTCCTTCCGACTCGAGAACAACTTGGTGCGTCAACGGCAGAAGCTCGATCAAAGCAGACATCGACAGCAAGAAATCCAGAG
CGAGTTGGACAGTGCGTACGTGCAGGTGAAGAGATGGCAGCGGATTGGTAAGAGCCTGTTGCGAGTGTAGAGCAGTTTCGATGCTAACATTTCGCTGTTT
GTCCCTTTGAGCAGCAACCACGAGCTATACCCAGGCGAAGCGGACGAAAGCTGAGATCGAACGGAAGGTTTTCTCCACTGTGGACCGCATGCTGCAGAAA
ATACCAGAGCGTAAGCGTTTGTGTCGGTGTGCGAGCTGTGCGAACGAGTGGGGCGAGATGGAGCGCACAGCTAAGGAGTTCGCTACTGCTTTTGGTCAAG
CCAACCGACCTTCGTGCTGCGCGCGCCACGGCCACCCCACACGCAGGAACATGGCTCCGACGTCGAGGTCGCAAACAGCTCTGCCGTCTCATCAGTGCGA
TTACAACTTTTAAAGATCGCTGCACATGCTCTGTGCGGAAGTCTGTTTGGAGACCTTGTTTCTCACAGGTGGCGTGCTGTGCAGGCACCAAGGCCACAGA
CGGAGTGCTGTGTCAGGGCTACAAAGTGTGCGAACAAATGGGAAAAGCAATTGTGTAGCTACAATAGTTGCCTTTGAGTTTACTGGTATTTCTGTCTTCC
CCGAGGTGGTCTTTGGCCAATTTGTCAATCGCATGACGATCCTGTCACAATTGCACGACTTTTTGAGTGTCTATGTGTCGATTATGCCTCCTTTCTGACC
TGTTCGGCTAATCAAACGGCAGAACAGGAATCGCCACTGCAGGCAGCGAAATGGCAGGTGTTGGCAACGGCAAATTGCCACTGACGAATTACCACTGGCA
GTTTGCACACCACCTCGAAAGCACGCGAGGCAGACAACAAAGGCACTCTTGCCATAAAAGTCCAAGAGCCTGTCACGCTGAACCGGACATCTGCTGCATC
CGGAGCGATCAAGAGACGAGTCGGGAACATCTTGGGTCCACTATGGGTGGGATTTCGAAGCTCGAAATGGGTTCCTCATGGCGATTGGCCGAAATGACGT
CAATTTTGGCCGCCATCCGTCTCACCATACAAACGCCAAGTGTAGCGTCAAGCCGGACGCGTACCGTAGCGCGCCCGTATAGCGGATCCCAAGGAGCTGC
ACGGTCACCACTGGTTCCTTCGGTGACGCAGCACAAAGCAATCAACGCATCCCGAGCCTCGGTGCGCGGGCTTGTCTCTGGGCGCCATCCAGACGCGACT
TGAGCTGTTCTCGAAGTGGCCGGACCGGGTCCCGCTCCATTATTCAGATAACAACCAAGCGGCTGCCGTTCGGAACAGTTGCCCCCCGTGCACGTGTAGT
GTGGCGTGGTGTCCTCTGTCTGTGGCTCCACCGCTAGAATATAAATACACTCGCAGTCGAGTACTCTTTGCTCCCTATCTCAGCCTCGGTGGATGCTGCT
CTTTGACCCTATCAAGCCCTCGCCCTGCATGAAGAACTCGGCCAACCCCGACGACGTCGACATGAACGCAGCCTGGCTTCCGTCGGCTGACCAGGCCCGG
CCGGATGCGCAGGCTGGAGCGCTGCCGGTGCTGCAGCTCGCTGCAAACCGGCACCACCTAGCGGCCATCATGAACACGGATGCGACTGCGGTGGCTCTGG
TCGGACGTGCAGCGGCATCCAGCAAGAGCTCGCTCGCGTTCATATTGGGGGGAAACGCGGACGAAGACCAATCTCACGCGACTGGTGCAAGCTTCGGTAC
GTTACGCTAACAATTGCTGCAACGTTGCAGACGAATGCCTGGATTTGCACTGCAAAGGTTGCAGCCGTGGATGGCACGGACTGATCGCGTGTTTGCTGGC
TTCATCTTGGTGCGTGTTGCAGCTGACCTTGCGATTGCTTCGGGTGTTGCCGCTACGGAGAATCGAGCGGCCAATGTGCCGGCACCGGCGGCCGCACCGT
CGAAGGCGACAGTGAAGAAGTCCCGAATCTGCAAGTTTGAGAATTGCACACGCTACGTGGTGAACCGAGGACTGTGCATTGGCCACGGTGTAAGTTGCAG
TTTCCTTTCCTCTTTCGTTCGTGTTGCACTTTGGATCTAACGGTTGAACATGCGCTGTGCAAACACACAACCAGGGCGGCAAACGCTGCGCGGTCGTCGG
GTGCACGAGCAGTGCTAAAAATTTGGGCGTGTGCTGGAAGCACGGTAAGGATGGCGCGATTGCCGAAAAAGGTGGCTTCATGATTTGCTCTGACAACGTT
GCGTAACATTTTCAAGGAGGTTCCACCGAGTGTACTGTGGCAGGGTGTGAGAACCGAGCAAAGTCTCGTGGAGTTTGTTGGTCTCACGGTGGAGGTACGG
AACTTGAGTGCCAATTTTCATTCCTCCAACCTTTTCTTACTTGAATTTATGGTTTAGGTCGCAAATGCAGCGAGGAGAACTGCACCAAGACGGCAGTTTC
GCATGGTCTTTGCTGGGCTCACGGAGGAGGTGAGCTGCTTGTCTTGTGCATTTTTCAGCTGTGTAAATTAGCTATTCAGGCTGCGTGTGTACTTACGTGC
TGGAGCTTCTTTCTCTTGCCCTTGTTATTTATCACTTGTTATGACCCAGGCAAGCGATGCGTCGTGGAAGGATGTCGTAAACCCGCGTACGAGCGCAACG
GCAACGTGTGCTCCCTGCATCAAGCTGCCAAGCCTGGAGCTGTGCAGAAGCCTGCCAAACGATGATGATGGGCCCCTCGCTCGTTTTGCGAGCGTACTCA
TAGATTTGGGAGGCTTTAGCAGACTGAAGCCTCGTTGAGGGGACGAATAGGGAGGCGCGTTGAATATTTATTGTCATGATAGTTTTGACGCACTTCGAGC
TTGTAGAAAAAGGCAATCCAAAATTTCTTGCAATTTGCTGTTGAACGGCAAAACTTGTGCTCACGTGTTTCTGTGGATTATCAAACGATGACGATCACCG
AAAAGACGAGGCAAGTTTAGCACCGTGAGTGAATTGGGGGGTGGACAACCCAAGCAGCGAAATGAACAAAATGCCAGCAGTGCAAGTAAAGATCGAACTT
CGGTCTACCGGATGTACATGCTAATACATGTACTAAGAACTGTTTTGGAGGAGGTAGGTGCAGGCTTGGTGATAAGGTTGGATACTCCCTGGATACTATT
CATACATATGCGCAATAGCTTTTCACCAACGTCCATCTGAATAATTTATGATACATGAACAACTCATCGTGATAACTTCGTTCCCGAAATATTGATTTTC
TCTTCTTTATACATAATGAGTGAGTAACGCCTTACGCTATCTTCCATTGCTGCTTGCAAGCACTTGGCTTGAATAGGTAGGATAGACTTCCGTCGAAAAT
AAAATAGATGCTGTGAATTCTGTAGCCTTGAAAGCCACGCAAGAGCTTACAGCTTCATAGCGCCATTCTTGAAAGCCATCGCCACCTGAGCCATCGTTGG
TCGTCGAGCTGGATCCGGTTCCAAACATGCAGTAATCGTTTCCTTCATCACACCGGAGCAGAGGCGGCTCAAGCGGAATCCAGTCTTCTTTGCAGTTGGG
GAAAGCTCGTCACGCCCTGACCTTTCCATCGTTAACCTCCTGGCGTTCATAACTGGAGTCTCGCCGGTGTCAATTTCCACAAGGACCACGCCGAATGCGT
AGACGTCCGACCGTTCTGAAGGCTGTTCGCCGCGCAGAATCTCAGGGGCCACGAAGATCTTGCATTCATTGTCCAGAGGCGACAGCTTGACGTAGTGGAA
GATGCTGAAAAGACTCAACTTGGCTGAGTAATCCTTGTCGAGCAGGATATTAAACGCATTCAACCGCCCGTGGATGATGTTCTGCTTGTGCAGGAACGCC
ATGGCCTCTGAGATCTGTCGAGCAATGGCGTGCTGCTTCGGTACTGACAGCTCCATCGCGTTGTTCACCGTGCAGTCTCGTAGTGCACCCTTCTCAACGT
ACTCGACCACCGCACATAGCTCCGTGCCATCTGCATCCCACATAGCCCCTCGGAACGCTGCGATACGAGGGTGTTTAAGCTCAAACATCAGCTCGATTTC
CGTCACGAAGTCGCGTAGTAGTGCCTTTGATGCTGTGTTACTCTTGATCTTCTTGACGAGCACAGCCTCATGTTTGTACTCGCCCAACCACAGCTCCGAA
CGGCTGCTAACACGCAGCATCTTGTGCAGGAATACATCATCGTACGACAACCGAGTGAGTCCGATGTAGCCATCTGCCACAGACGCCAGCAACTCGAAAT
CTGACGTCGTCTGGCTAGACGCATTGGAACGGGGAACTCCCAGCTCCATGTACGGGTGATCGGAAAAATCTCCCATGCCAATCGAAATCGATGGGATGGT
GCTGTTCATCAACTTTGGCTGCTCATTTCTGCGTCGGCGACAGCACCACCAGATAAGACCAACGACCAGCAAAAGCATAACAGCTCCCAAACACGCGCCG
AGAATGATCCATGTCTTGTTTGATGAAGAGGAGGTGGAATCTCCCTCCGTTGTTGTTGGCACGGTCGTTGCTGGCTGCTCTGTAACAGTGGAGTTCGAAA
TGTCGTCGTTGCCCACGCAGAACGTGAACGATTCATTCAGCGTGTCCTGAACTGCAGCGGTCGGACACGCACTGGTGTTTGTGGTGCCATCGATCGTGAA
CATGCTAAGGCCGGCGAGGAAAGTCAGCTGTTGAACTGTCAGATCTGATGCGTTGATGGGATTGTTAACAAGCGTCAGGAACTGCAGCGTCGAAAGGTTA
AAAATCACGTCGGGAACTGCTTTTAATGAGTTGTCGCTCAGGTATCTACATTCACGCACACACAACATCAAACTGTTAATTAAAATTACACAGGTAATGA
CCAAAATGTGCTTACAAGGTCGTGATGGCTGGGAAGTTGTCCGCCACAAGACTAAAGTCAGTCAGGGCATTTGACGATAAATCACTGCAAAAAGAAAAAA
AAAACTATAGTCAGCTCGATTTCTAAAGGAATTGATGAGTTGGTGACAGCACGTACAGCAAAGTGAGGTTGGAAAAGGCTTCGTCTTGGAAGTTTGAGTC
CACATTGGTAATGGCATTGCCAGCGAGGTCACTGCAGTAAACACCTTCCGGTCAGACAAGATTCACCGACAATACAGCAATGGGACATCGTACATGACTG
TGACGGAATCACCAGCAATAGCGGCGGTGGGGATCTCACTTAGTGAGCAGTTGTTGAAATATCTGTTCATCAGCAATTAACACACAGTCCTGTCAGGTTC
CCCTTGTCTTTGAACAACGTTACAGTAACGCACATTCTTTTGACGCTGTTGAGCGGCAGGGCGCTGTCCAGTCCCGACAACGTCAGGTTCTTGAACGTTA
CTTTGTCCAGTGTGGCATCCGGTTGAATATTCATCGACGCGAGTTCCAACATCCCGGAAAGCGGTTCCTCTCCCTGGTCTGCCAAACTGAATGTCAGGTC
TGTAACATGGTCGTACAGCTGGAGCAGTCCGACACGTTCAAAGGGGCCGGCGCCTGCTGTATCGTTGCTTTCTGCGGGCTGGAAGACCCACTCTGTGGCT
GTGGAGCTGAAGGCGTCGAGACACAGCGCCGACTGTCCCGACGACAGCGTGACGCAGTTGGTGTCGTTCACGCAGTTAATAGAGTTGGCTGACGACTGAC
CCACCACCACACAGGCGCTGTTGCTGCTGCAGCCGCCATTGCAGCTAGTAGTTAACGTGTTCAGAGTGCCGCTGGTTGTCGTCTCGCTGGAGCCTGAGGA
GCTGGCAGCGAAGACTTCTCCACTGAGCAGCCCCGAGACGCCGAGCGCCAAAGTCAACCACGCGCGCATAGACGGATACACCCTGCAATTAGGAGGGGGA
AGATAGAGAAGAATCAGCTTTAATGACGGGAGAACGGGAGCTTTAAGGCGGACGCCGTACAGGTTGGTGTCACAGAGCAGCGAGGATTCTCAGCTGTATC
AGACGTGTGTGGGGAGGTCCCTCCTGGAATACACCCCTACAGCCACCTATAGCGGCTCGCTTCCGAATAGAAGGGAGGCTTCTGGGGGCGTGTGAATGGC
AATGCAGCGTGGGCTCCCGCGGACGAGTGCGCGCTCGTTCCGCGGCGAAAGCCGCCTCGCAACATGACGAAGCCATGTTCGGCCAGCAGCTCCGATGACT
ACTGTGACGCTTTTCTGCCAATAAAATAGCTGTAAATTCGAGCGAGAGGAGTGGGTAAAATCAGAACGTGTCAAATTCGGCGCGGCTATTGGCTCACGAA
AGGGCGTCCGCCCCGTCTATGGGCAGTTTTTGATACTGTATGTAAAGATACTTGGCTCGGATACCTTCACTTTGCAATTTGTGCGGCAAATGGACGTTGC
AAGTGGCAAATTGTACGCCTTGCTTGGCTGTTATGGAGAGATTTCGTGTCTATCAAGTCGCTAGAGGTGAAGAGCTGGCGCGATATAATATATTCTGGAC
ATCTCACCGCAATTTCAGCGGAGACGACGCCCTTATAGGCTTTACTGTAGTGTACGTGTGTCCGATCAAGCGCCACCGAATGATCCAAGTGTCGCTGGTA
CAGGCTGTCGTCCGCTCTGGCCTTTTGTCTGCACTTGCTAAAAGATTCATCCTTCCTGCTCCTTGCGTAGCCATGTGACTGCAGCGACGAAAACGTCGAG
AGCTTGACGTCTCGCGAGAGGCAGATACTTGGGGTCCAGGATCTGCCTCATCAGGTACAAGCTACTCACGGGGTTTGTGGCGAGGAATGTGTGTCGAGCT
TGGTGTTGCAGCGCCCCAAGCAACTCCACAGCTGCTAACTGGTGGTCGGTTGCTGCTACGGCCGCAGTGGTGGTGCTAGCCCGTGGCAGCGCAACCAACT
GACAGACGAGATCCAGCAATTCAACCGGCGAGCTGCAGCTGCAACTGCTCCACGGCATCGTGGGTTTGCTGCTATCCACGACAACCTGCGGAGTGCTCTG
AAGCAGTCGAGCGGATGCGTGTGCGTCCTCCTTGACGAAGTTCCGCTTCACCTTTGACACAATTTTGAGGTAAATAGGCTGCACAGTCACCACCACGAGC
TTGGCGTACACCACGTCGTGTAACTCGCTCGAGTTCTCGTCCAGCCCAGTGATCTGCATGAGCTCCGTGATTTTGTACGTCATGACTTCCTGATAAAGAG
CAGACACACAGAGCCGAACACTCTGCAGTGTGGGGCCTACACCCGAGATCCACACGTTCTGCTTAAAGTCCAGCCAGAACTTGCGCAGGAACTGCGTGGC
AGGTTGCCGTCCATCGACGAACAGCGCCTCGAGAGCCATTTGCATCCGTTCTCGCATCTCCGGGACCGAAACGAGCAGAACGCAGATATCTCGGAACGAT
ACAAACGGCAAGCCAGAGTCCTCGCTGGGGCCGATTGAGCTGTGGATCGACGAATCGAACTTGCTCGCTGTAAGGTTCACTGGCCCACCGCCTCGGTTGC
TTCCGTTCAAGGTCGCTCCAAGCACGAACGAAGCTGAAGCCGAACTGGTGGCGCTAGTTTCGTTTGATAGAATCTGCTGCGAGCGTAGCTGGTGGAAGCG
AGAGGTGGCGAAGTCCATACTGAGAGCTTTGAAGAACTGCTGCAAGCGTATAGTCATTGCCGCTGCAGTTTCACTTGGCGCTGCCTTCCCACGTTGTGGG
ACTCGAGACGGTCGTGGTGCAGGCTTGAGCAGTGCGTTCTCAAGAACATTGAGTACCATATACTGTCGCTCCAGCTTCTCCACGTCCAGCATCTTCTTGG
CAGTGAAGTAGCTGGTAGACCGCAGTCGCTCAAGCATAACACCGATAACACCGATGAACGGGATGATCGAAGTAGTGGAGACGTCACTAGACAATACCGG
ACGAGCGCTTTCGGCACTCTGCTTCCTTCGTAAGTTCTCGAAGCCTCCGGTGTGATCGCACAGTCGTCGTAGCTCTCCAAGACGCGTTTTGTACTTGGCA
CGGACCTTTTTCCACGTCGTTGGCATTCTAGAAGACATCAACGGTGTGTCACCGAGACAACCGACACAAGCCATGACCAGGTGGAAGTTGTTCAGTGGCG
GTGCACTTGCTGCCATTGCGATGGAGATAATATCCTCAATCACCTCAGCTCGCTCCTTGGGTGAATCCTCAACTAGTACGGACCAAACGAAGTACGCTAC
CAATCGGTTGAAATGGTCCGTCAGCTCCTTCGCAGCTTGTTTCGGGTGGTGTAAAAACTCCCACGGATGTACATTTGTGAGTTGCGAGTGGTGAAAGACA
GTGAGTTGTTCAGCCATTTCGGAACACGACATCTCCCACAACATACTTCGAAGGGGGACTGGAAGCGGGATGTCTTCACAGATTAAATCGAGTTCATCTG
ATGCGCTGGCGGTGAATGGGATGCTTGGACTCAACAGCGGAATGTGGGGATCTCTTCCACCTCCTGGAGCTGGAGACGGCGTCATCGGTGCAAATAAAAG
TGATAGATTATCCCGCAGTCGCTGGCCTCCTTCCTCCAGTTTCCTCGAGCTGATGGATCTGTCGTTGTCGTCTGTTGAAGTTGGTAACAGGCCTTTGCTC
TTGGCAAGTTGAGAGATCCCTACCAAGTTCGGGAACGAGTGATTGCGTCGCTTTCTTCTTTGTAGACGCGGTGGATTCGGCGTTGCAGTCGGAGTAGGAA
CGGAAGTACTGGATGGATCTACATCTGCGTCATTTTCACTCTTTGCAGTGACTCTGTTAGGAACTGGCTGAACCTGTTGATACTCCGTATCGTCGCTGAA
TCTCCGCAGTCGACAGTGAGGGAAAAACAAGTCGATGAGACCTTGAACAACATCCGTGTTGACCTCTTCGCGCTTGGAATAAATAGGATGGAATAGGATA
TCGCGAACAAAAGATGCCACGTTGTGCTTTTGCGTGCTCAAAGTGCGCGGCGTGAACGAACCTCGACGCGGGTTGTCCCTCTGTTTTTCCCCTAGGGCTA
AAAGCATATCACCAACGTTGATTCCTGCAGAAGCCACCACTCCGAGATGCAAAAGCACGACACGACCACCGTGTGGAGTGCTTTCAATCATCGCCAAGAG
AGATCGGAGCCGTTTCTGTCGTAGTTCCTCCTCGCTTCGCTTGGCACTTTGGACTCGTCGTAGTGAGGGAGCAGCCTTTGTAAAGACTGGAGTCGGATGA
TCTCGAGGGTTAATAAACGTATCGATCTCTGCTGCCCCCATGGATAAATGACACTGCATGACGGAATCTCGCACACTCTGCAGCGCTAGAAGAGCGTCAT
TATAGCCTTCGCTGTCATCGTCCATCGTATCGCTCTTCTCCGTTCCCATACTGGTCATTGAGCTGCGTTTGTGCCCTTCATGGTCGTCTGTTTCATCCCC
AGAAAGAAGTTCCGTGCCATCCTCGTCGCAATCCACATCGGAACCAGGTCGTTCCTGCGCACTTACAATGGCGCTGATCCATTCATCACGCGTCACGGTG
GAGCGGAAGTCGAACACCGTGTCTCGACCGTGCATGGAAATTGTAAACAGCGACTGGCCTCCAAGAAACGTGAGTTTGAGGCTAGTATCAAGCAAGTCAA
TCTGTAAACGAGAACTGATTAGCATTGAAATCGTGTATAGCAACAGTTAAAATACCAACCTTTGCCTTGATGGAGCCCTCTCGTCGTCGACGGATGATCA
TCTCGCCCGGTTTAACGAGAACATAGCGGTCGCGCCACTACAAAACAAAGCCGACTAGTGAGAACACGCTACGTGGCCGTAGAACTGCATTGATCTGCTG
TACCATGAAGTGTCCGCGTACGGCGACGCTGCCTTCTTTGATGGTCTCGTAGATGTCGTCCATTCTGTATCAGGCGCTATTCATAAGCGAACTTCTAACC
GAGACAGGAAAGGAAAGCTGCTGCGAACGCACCTGGACGACGACGCTGCCGGGTCCATTAGCTTGATGCACTGCCTTGATATATATGCAATCGAGTGTCT
GCAGCACCGCGGGGCGAAGCTGTATAGGGTAGACAACAGTCGAAGCCTGCTGGTCCTTTGACTATCCGACGTTCAGTCCGTTCACCACTGGCAATCTCTT
CCGTTCGGGTGCATACGAACATCGAG