Description :
From Genome Similarity Track
Location :
Scaffold_1501:1335- 2987
Transcript NameFunction/comments
Phyag_g10806Folate-Biopterin Transporter (FBT) Family

Sequence
1652 bases(100 bases per row)
TTGTCGTCGGCCTGCACACGGGCATTGGTGATGTTGAACGGACCGTTCatgagcagcgtcagcgtggTAGCGAAAGGCGTGGCCAGGTTACCGACCGTAG
TCATAAGACCGTACACGGCACCTTCGTTGCCGACACCAGCGATCTCGACCGTCACGAACAGGGCAATGATCCAAGCAACACCGGACGGGACCTGCACAGC
GATGGGAGGGCcgagccagaaccactggtTACGGAAGATATCCCAAACCGTGATGAGGGCGACAGCACAATCTACGACGATCACGACAATACCCGTGTAA
ATGATCATGCGGCGCCAGTCCCAGTGGAGGCCGTACTTGGACGTCACCATGATACCCGCCATGAAGCACAGGTGACCGAGGACATCGTTCAGGGTGTTGT
TGATCGGAGTGACTCCCACCATGTACGACTGAACGGGGGAACTGGCAGTGTACGAGATGGCGGAGAAGATGCCGGCGAAGAAGTGGTGGGCGATGACTTG
GTACACCACACGCTTGCAGAGCAGGTCCCAGAACTCGTTGATGTACTTACGGAAGTCAGCACgctcggccttctcctccttgataAAGTACCAGGTGAGC
GGGACGGCAGGAGCAGTGAGCACAACCATGATGATCATGAGCTCCGGGAAACTCAGCGAGAAATTGAAGTCGCCACCGTAGTCCTCACCGTTGAAACAGA
AACCCACAAGCAGTTCACCGAGAATCACCAGCGTCGTACGAACAGTGTAGATGGCCGACTGCGTCGTACCGCGCTTTGCCATAGGCTCCTGCTGGGCGAG
CTCGCACACGATACTGTCCGAGCAGACATCGGACAGCACGTAGCCGAGCGCGGCGAAGAACATGATAACGACGTACTTGGCACCTTCACCGGGAGCACTG
TGGTTGATGCGAGCTTCAATTTCTGGCGTGTAGTCGGCCGTGTCGATCTTGCGGTCAGAGGCTACAGTGTAGTACGGCTGGCCAATGGGCATGATGGCCA
TGAGCAACAGCATCGAAATACAGATCGCCCAACCGATCACCATGTACGGACGGCGACGGTAGCCGAACAGTGGGAAGCAGTCCGAGATGATACCATAGAA
CACCTTAAAACTCCAAGGAAGAATGACGAGTTCCTTGGCGGCAGCGACCTGAGCACCGGAACAGTTGAGGTACTGCTGCATGAACGGGTAAATCGTTTCG
GGAAGCATGCCGTAgacgacgccgacagcagcgtaCTGGAAGAGCAGACCGATGTGATCCGGGCTGGTCAGTTTGGGCATACCACCCGGACGCAGAGCGC
CGtcctcaagcagctccgGGGTGCCGTCAGGCGTCTTGACACCCGCATAGCTGTCTTGGTTGCCGTCCTTGGTGATACTCTCTTTGGTGATACTCACAAC
CGAGTAACGCTGCAGGTCGTGTAGGCCGCTGGGAGTCGGAGCCATTGCGAAACCTCGAACGAGCTTGGGAGCTTGGTAACACTTGTGCAGTCCgaggcaa
gaagcagaatGAGGTCCACAGAGCTGGTAGATTAACGAAATTAATGCAAAAGACTCCCTGATCGTCAGCCGAGGAGAAGCAGTCACAGGGCTAGCAACCA
TCGATCAAGCAAAAGAACCCTTGCAAGCCCAGCCTGCGCACCATCGCCAATC