Description :
From Genome Similarity Track
Location :
Scaffold_2327:1335- 2691
Sequence
1356 bases(100 bases per row)
TAAGGTTCGGTCCAAGCTCGTGAAGCAGCATCGGCCATCCAATTCGTCGACCCGGGAACATGGTCGGCCGATACTCGAAGATTGAAAAATGCTTCTGCCA
GCCAGCCCAATCGCTCGATTAATTTCTTGACTAAACGTATTGTCGGAGTGTAATCGATTACACCAGCTcaccgctgctgcattgTCGGTCCAGCATTTGA
CATGAATTATGCGGCCGAGCGATTGCTGGTTCCATTTCGAGCCCCAAGTCCATATCGCGAGAGCAATGCTAAGATGTTCCCGGACGTTGATCGAAAAACC
GTCCCCATCGCCACCAACTTGGTTAATAAGAGTTGACTCATCCGAATCGAACTTAATCTGAATGAAGAAATCACATGCTGGATCTAGCACTGCTAACCCG
AGGTTAGACGCGTCCATGTAGAGCTCGACGTGTGGGTTCGGTAATTCTCCAAACATCGCAAGCGGTATTTCTGCAAGACATCCATGATTCAAAATATGCT
GAAGCCAAACCAGATCTGCTTTCGCACCCTCCTATAGTTGGATTCTACCAAACCGAGGTGCAGGTGTACACTGGGACTGCAACCTTTGATAAAATGGTTT
AGCGGTGCGCAAGCAGTTGGCAACGTGCCTAagcgagctcagcagcttgtagaGTTCGGGTTTTGAGGACGTGCCACGTTTCCGCATAGCCATGACTCGA
TCTCGAGCTTTGGCAATTTTTTCTTCAGGTATGGATACTGTGAGCCGTTCGGTGTTCCATCGCAGACCCAGCGCCACTATTTCAGCGCTCCACTCTGAGA
ACTTTGCCTCGTTGATTGGGCGAGGTCCTAATACAGCCAGCACCGCGTGGCGTAATGTTGCTTCAGCGAGTTCCAACCGGTCATCAACATCACGTTCTAC
CAAAATATGGTCATCTACCCACTCGTAAGGGAAGAAAGGGTCCGCGTCGATTGAGTCCGATACTGATGCTGGTGAATTGCTCCCCATTAGCCAGAATATT
GCTCGACCAAAGAGAGCGTAGCACGGTGGTGACCCTGACCACCCAAATGGAGCCGCCATGTCGACCACGAGAATACCCAGCTCTTTCACGTGGACTGCCA
TTCGGAACACTTGGTTTGCTCGGGTCGGTAGATGACGAAACGCGCTTTTTACGTCGCCCTTGAGGATACAAATTCGTCTAGTGTGATCATCTTTGGCTAG
TTGTTCGATGCGTCGAGCGATAATTGTCACCGATTCATACCTGACCTTTGGCACGGACTCAGCCACAAACGCAGTGTTCACAGAATCATCCGTTGGAAAT
GATAAGTCATGAATAGTGCGCACTTCTACTAACGGGTCGGCACCTTTCTTCTCAAC