Description :
From Genome Similarity Track
Location :
contig_204:13349- 14550
Transcript NameFunction/comments
g12069.t1hypothetical protein

Sequence
1201 bases(100 bases per row)
GTCGCGGCTCACCAGCACGCGACTGCTCTCCAGTTCTTCGAATCGATACGCTTTCTCGTGCTCCGAGTACCCCAGGAACCGACAGCGCACCGACCGAGCG
TCGAACTTGGTGCGCTTCGCCTTCGGCACGTGCACATACGCGTGACAACCGAAAACTTTCAGGTTCGCCAGCAGCGGCTTCTTGCCAGTCCAAACTTGGT
ACGGAGACTTGTCGTGGCTGACGGCGCGTGTCGGACACCGATTACGGAGGAACGTAGCCGTCATCACCGCTTCGCCCCAATACGTCTTGGACAATCCGGC
ATGTTCCAGCATGCAGCGCGCACACTCCACCAACGTCCGGTTCATCCGCTCGGCGACTCCGTTCAGCTGAGGCGTGTACGGCGGAGTGAACTTCTGCACG
ATACCGCGGTCCGCACAGAACTTGGCCATCGCGCCGGAAGTGTACTCGCCACCGTTGTCGCTCCGGAGTGTCTGCACGCGCTTGCCGGTCTGAGTTTCAG
CAAACGCCACAAACTCCGCGAACTTGGCAGCCACCTCGGACTTGTTCCTCAGCAAATACACCACAGAAGTGCGACTTGTCGTCGATGAACGTGACGAAGT
AGCGCTTGCCCCAAACGTTGGCGTCTGCATGGGGCCGCACACATCGCTGTGAACCACCTCCAGCACGTGCTTCGCGCGGTTCGGGGACGACTTCATGTAG
CTCACTCGCGTTTGCTTGCCGAGTGCACACCCGTCGCACAGCTCCCACTGCTTCACCGACGTCATGTCGATGCCAACACCGTAGCTCTTCTTGACGATGG
CGTCTAGACCGCCATGGCCAATGTGACCAAGTCGGAGGTGCCAGAGGTACGACGTGGTGTCCCCTTGGCGATCCTTCGAACTTGCCGCATTGGCCTCGTC
AGGCATCATCGGAGTCATGCACAGCTTGAACAGCCCTTTGCCCTCACGAGCGCCGAGCTGCCACTTGAGACCCTTGTTGTCCGCGAAGCACCCGTCGCTC
TCGAAGGTCACTGGCCCGACGTCCTTGGTGAAACGGCCGACCGAAAACAGGTTGCGCGACAGTTTCGGGATATGCCACACATTCGTGAGCACACCCTTCT
TCATGCCGCGCGGCGTCTTCATCGACATGACAATGTCGCCGGTCCCCACCGCCTGAACCACACCGTCGTCCGCGAGATGCACGTCCACCGGAGCCATCTT
C