Description :
From Genome Similarity Track
Location :
Scaffold_447:13347- 14884
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_447-fgenesh-gene-0.3Mitochondrial-processing peptidase subunit beta

Sequence
1537 bases(100 bases per row)
TTAGTATCGGGTCCAGTACGAGCGGCGACGGATAAAGTTGTAGTCGGGCAGCTCGTGGATCGGACCGAGGGCCGCGAGTGCGTGCTCCTTGTCGTTAATG
ACCTCGTCGGCCGTGTTGCGCACGGCGGCGGCGTCGACGGCGTCGATCCGCGCGAAGATCTCGGCCGGCGTGAGGCGGCGACCGTACGTGAGCAGCTGGC
GACCAATGTCCTCGCAAATGGGCGACGTGCCGTCGAGCTGCATGAGCATGTTGGCCTTCAGCTGCGTCTTGGCGCGCTCGACTTCTTCGTCCGACGTCTT
GTGCACGAGACGCACGAGCGCCTCCATCGTGTACCACGTCAGGTCGTTGAGCTTGTACTGGTCAGCCACGGCGTAGACGCCGAAGAGACCCGTGTCCTGG
TAGCACGTGTTGAACGCCATGAACGAGTGCGCGAGTTCCTTCTCAGCCACGACCTGGCCGAGCTTGGACGACATGTTCATGCCGGCACCCGACGTGCGGT
CCCACTGGCCCAGCAGCGTCTGCATCACGAGCATCGCGAACGCGTGCTCGCTCGTCCAGCTAAAGCCTTCGAACGCGATCGCGACGTGGGCGAGCGGCAT
CTCGTCGTTCTTGATGCGCACGTCCGAGCCGATAAAGTTGACGGGCTCCAGTGCCGTGGCCGACGCGGGCGCCGACGACGGCAAGTTGCCGAACGCGTTC
TGCGCGAGCTGCACGAGCTGCGCGTGGTCCACGGCGCCGGCACCGGCGACCACCATGCGCGGCGCCGTGTAGTGCGTGGCAATGTAGTCCTGGAGATGCG
CGCGCTTGAGGTTCTTGATCTAGAACGAGACAACACAAACAGTGTAAGCTCAATTGGACCTAGATGAGATCGAGACAGAGAGATATCCGTACGTTCTCAA
TGGGGCCGANNNNNNNNNNAACGATACAATCAAAAGAGTTGAGCTCAGTGGGATCCAGATGAGATCGAGGCAGAGAGAGAAAGAGACGTACGTTCTCAAT
GGGGCCGAGGATCGTGCGGCCGAGGCCCTGGCCCATAAAGGCCGTCTCGTGGAGCCGGTCGAAAATGACCTCTTCGTGCTGCTTGTTGACCTCTTCCATT
TCACGCAAGATCACATCACGCTCGCGCTCAATGGCCGCGTCATCGAGCTTCGAGTGCTGCAGAATGTCGCTGAGAATGTCCACGGCCTTGGGCACGTCCT
GCTTAAAGACCTTGGCGTAGTACACCGTCTGCTCGCGCGACGTGTAGGCGTTCAAGTGGCCGCCCATGTTCTCAATCTCGAGCTCGAGCTGCTGCTGCGT
GCGCTTGTTCGTGCCCTTGAAGGCCATGTGCTCGAGGAAGTGGGCCGCGCCGTTGTTGGCAGCCGTCTCGAAGCGCGAGCCGGCGCCGATCCAGACGCCG
ATGGTCGCCGTCTCGCCGTGGGAGCCCTCGGACGCGACGCGGAGGCCGTTGGGCAGCGTCGTGACCTCGGTCGCCGGCGCGTTCAGCACGTACGACGGGT
AGTTCTGCACGGCCGCGGCCGACTGCGCGCGCGCGAG