Description :
From Genome Similarity Track
Location :
Scaffold_1:1334240- 1344312
Transcript NameFunction/comments
Phyin_T30-4PITG_00210Putative uncharacterized protein
Phyin_T30-4PITG_00211Adenine phosphoribosyltransferase%2C putative
Phyin_T30-4PITG_00212Putative uncharacterized protein
Phyin_T30-4PITG_00213Putative uncharacterized protein

Sequence
10072 bases(100 bases per row)
ATCGTCGCTGCTGTCGTTGCATGAACTTCCGCTTCCGCCACCACTTTTGGATAGTCGTCGCGTAGGCATTATTCCACATTTGTGCTAAAATCTCTTGACG
GCGCTGATCCTCCAGACGAACCTTCAATTCGTAAAATCGAGCTCGCGCTTGCTTCGCACGATATGCATTCTGTAGCACTACTGCAGCCGCAGTTTTCCGC
TTCGACGCGCTTTCCACGCGTAGTCCAAAGTTGCGAATGAACCGCGTGTATCGGAAAAACTTCAGTAGTACCCGCCTTGCTTTTGCTAGTCTGGCATGCC
TCGCTTTGGCATGCACAATTCGCTTTCTCCTGCGTCGTATCCAAATTTGAATGGAGACTGCTGCACGATACCTCGCTACGTGGTGGATCCATGTGAGATA
ATCCCGCTTCTTCTCAATGTACCGCACTAAAGTACGTGTGATCACACGAGCTGCTCGTTGCTGCGTCATCCAAGCTGCACAACGCACGCGAAAAAGATAC
GAATGGTAGAAGCGCCGCACCCGAAGCGCAGCCTTATTGTACGCAATAAAGCGTTTTTTTCGCTTGACCATTTTTCTAGAATAAAACCCTCGCCATTGGG
CTTGAATCAATGTCGCGACTTGATGCAGGTGATGAACAGCTGCTGCTCGTCTACCTTCCACACCGCGTATCCAGCTTTGTATTGCAAGAGCAGCGGCAAT
AATTTCGTCTTCACGTTGACGAGCAACATTCGACATCCAACGACGCCATAAGCGAAATACTACACATTCTAATCTCTTGCGCGATCTGCTAAGAACAAAC
AACGCACATTTTCTAGTCGTATACATGTAGATCAACAGAACGCGTTAGTATTTTTTTATAAGACTCTTGCGTCTTCACAAACGTAACTTACAGCTGACAA
AACCTTCGAATTTGGTTGTAACATTGCGCCCACATCGTTTGCTGCCGCCAGTGAGCAAACCGATGGCGCTTGGCTCGATGAAAATATCTGGACACGACAA
TCTGATCAAAACGTTAGAGAAGAAATCAAACTCGACTTTGATAGTGGTCTTACCCATATCTTTTCAACCGCAAATTGCTTTCTCATTGTCAAGGAGCGAG
CTATTTCTTCTACGCAATGATCACGGACCCATTCCCGAATTTCGAGTGGGCAATCGATCGTTGCCGGCCTTAGATATGCTTTGATTGGTACCATCAATTT
CTTTTGAGGTAATTTTGGCCGTGTTACAGTGCATGGTGGCGTTCGCTTCAATAGGATTATCTCTGGGAGTACCACACAGCTTGAGCGCGAAGCGGGTAAT
GCTCGGCCGTGAATCCATGCATTTTGCGTAAGCTTATCACATAGTGAGAGGGATCGTATAATAGGAGAGCGAGCTTTAGACCACCCATTTTGCCGGCGGA
GCATGACAAGACTCATCTCCAGTTCCATGACCTGGTCATACGTTAGTTTTGTTTCTCTCAGAAAACTTGCGTTTTCTAGCGTGTCAGCCACACTTGGATG
TGCGAGCAAGAACATATTATCTTCGCCAGTCAAGCATTTTAACCGAAATTTGTCCTCCCATATCGTAAGCGCGTGTTCGCGTAAGGTACTTGTTGGTGAA
TGTACGCCCGTGTTCTTGTCTGATGCCAGCATGAGAGGTTGATTCAAAGAGCGTGGAGGTGTTACCTTTGTTGGTAACGAGGCCACGGATCTATTGCGCT
TCGTGTCATCAATCGCTCTCCCTTTTAGCAGCCTAGGCTCCAGCAAATTTCGGGCCTCACACAAATTCCTTTGCTCTGGTAAGACCTCATTTAAGATGCT
GGACACGCTCCATTTCGTCCCATTACAAGCAGCAAGTCGCTGAATCAAGCTGACAAAGCCTTTAGAAACCACGCACGGCTCGTCAGTTTCAACTTGTCCT
GCCATTAGTATTGTCATCACCTGCTTCTTCACGCTTCCTACTACGTTCCGCCATCGATAAACAACACCGACTCGTGTCAGAATCAGTTTTTGTATTTACT
CTAATTCTGGTTGTTTGTTTCACTCGAAGTCCACTCGCAAATTCAGCTCCTTTGCTTCCATAAACTCGATAAGTTCTTGGTATTCGTCTTCACTCAGATA
AGGCCGTGTTGCGCGTAGTCCATCCATGTATAGCGCTTTACTCCACGCACAGGCTGCAATTCCTCGGTATAACACCTTCTTTGCAGCGTCCACCTTTCCT
AGAGCAACTTCAAAGCGCATATATAGCCCCCAGCAAAGCGCGTTCCCCTTTGTTCGAATCTGATTCACCATGCTTTCAAACATTTGTCGGATACGGTTAA
CTGCCGTCGCGTTCATACCCCAGCGATGATTCAAGCAGCAGACTTCGTCGACACTTGACTTTGACCTTTCCCTGGTCGTCGCAGCTCGCTCAGCACGGTA
AAATTCACAGAGCAGCGCGAACAGCCACTCCACCAACTCTGGTGAGTCAAAGTGTCGACGCCACCTTTTCTCTACCCGAAGGAAGTAATTGCGAAGCACC
TGTGAGATGGTATTTCCCGTCTCGGCATCAACAAAGAGTCGAAGAAACAGCTTGTTGGTTGAGAATTTCTCCACTGCTTCACCGATTGACGAACGCCATT
CACGAGGGGCGAGACTAGGAGCTACGCCCGACACTTGATGTTGCTGCATGAAATCGAGGAAGCACGTCCACATCCACGATACATGCGAACAAAACTGATG
CTCTGCGTTGGCCAAAGTCTGCCGGTATTCACGACAAGCTGCATCAAATCCGTCATAGGTGTAAACAACGAGTGCCAAGTTGTGCATACAGTACCCAGCC
CAACAGCTTGATCGATACTGTGAGCTAGTATTTCCTTCGAGCTTTCGCGTAGTTGACTCGACGCAATGCTGAATCGCAAAGTGGAGATCCGCTCGATATC
TCGCAATGAGATCAGTTCTACATGTAGTCGACGGATTGGAAATCAAGAGCTCCTGCAAGTAGTCATTAGTCCGGCTCTTGTGCTTCTTGGTAATCGTTTC
AAGCGATTCCTTCTCCGTGTTATCCAGTTGCCTCGCACTCCAGAGCGTATACAGACATCGCAACAATCGATTCTGCGCTTTTTCATTGTTTTTCTTTCGC
TCACCAGAGGACGACCACAATTCGAGACGTGCTTGAAGAAAGGCAAAACGATGGAAATCTCTTTCCGATTGCGTGTTGACGGAAGGAGATGCAAGTGACT
TGAGCGTGTTGGCACAGATACGCCGAACTTGGCGCTCGTTTCCAAGAGTTAGCTCCAGCTTAGCATAGGCGTACAGAGCAGTAAAATCTGTGTCGCCCTT
CTTGCTTCTTTTCGCTAAGATTTGACTCAAACGCCGAACGTACGCTATGCTTTCCTCCGAAGCTCCAAGTGCACGGATAACTTCAGCTTCGAAGCCAATC
CACAGACACTTAAGGGCACTTTCAAATTTCTCATCCGTCTCATGAAATGTATCCACAGCTTGCGCGAAGACTCGACGGATAAATGCCACCTTGCTGGGGT
CGCAGACCACTCCTCGCTTCACTGCAATGTCTTTAAGAAGAGCACTCTCCAGCAACATCTTACGGTCACTTGGATCAAGAAACAGCTTGTGTTTGCTGGA
GTTGGCAACGTCCGGATTAAGCACAGATAGAATCGGAGCCACGAGCAGTTCGTAGCCCGCAGAGCCGTCGCTGTACATTGACTCGCAACCTGGGAGACTA
GACTCCCAAGAAAATTCACCTCGCCACTCGACGCCGCACATCTGCAGGATCTCCGCGATAAGCCTCCATTGGTACGCCTTTGGAACAGAAAACAAAAAGG
GCTGGAGTTCTTCAGTCAGTGTAACGCGGTCTGGCTGATCCTCAATAAGATCTTGATGAAGAGGGTTGTTTGAACGTAACGGAGCCCACTGCTCTTGTAT
CTGCACTTCTTCACGGTTAAGCCATTGTAGAAAGCGGTCATCTCCGTCAATGGAATCGTAATTTGCACGTTGATCTTCCAGTTGTGAATGTGTCTCAGCT
AGTACTGCGCGTTTCAGCTTCTCCTTGTCAAGCAATTGAGTCTGCCGAGCACGCGCATTTTCCGTACCCCGTAGCTCGGCGAGAATGCGCTCGTACTCTT
TCGAATCGTTGGCGTCATCGACGTTGATGCGATACCCATGCAAGTTACTGTAAATCACTTTACCACCTCGCCTGGATTCCGTCTCGGATTCGTCACTTGA
TGCATCATTCGAGTTGATCTCACTGTTCTTCTCTGTCGCATCACTTCGACGTGATTGACGTTGATATGCTGCAGAAGCTGACAGCAAACTCTGCCTGTGT
ACTTCTGTTCGCAACACTTCAGGAGGATTCACTTGATCGACAGCGGTAACACACGTTTTCTGAATGAAATCTTGGAGCTGTACAAGTGAAGGCTTCGGAG
CGTCTGCCAATGTCTCAATGCGCGAGACAGTCTCGTCACCAAATCCAATCGCATCTTCCTTATTCCACCGTAAAGCAAACGTTCGCAGCAATTCCAAGTG
ACTCTCTCCGCTGCCACGCCCTCCAGTTACTGCACCCTCATTTCGAGTGAAATCAATTAGAGCTTGCAACTGAGCGAGTGAGCGTTCGATGAAGCCTGCT
CTATTCTCGAACTGGCACATGAGAAAATGAAAATCGAGCAGCAATTCCGTCAACTCCTTCGACTTCGCTCTCCCGCTTGTTGATAAAACTGGTTCAGTCG
TCGTTGCTGCAGCACAGACGCTCTCTTTTCTTAAAACAGAAATGATACGAGCGTAGAGATCGCGTACAGATTGCATTGAGAAGCTACCAAAATGTTGATG
GCGACTTTGAAGCAGCTTGAACCACAACCCACCGTTCATCGGATCTTCAGAGAGAAGACGCTCGAGTTGCTGTTGAAACAAGTCAACATCAGAGCTTTCG
CCAGTCTGCAATGACATGTTCAGTTTGACGCGATGCAACTCTCGCGACTGAGGATTCGTAGCTAGTGCTCTTGCAAGAATTGCAGCTTGCTTTTCCACAA
TACTTGCTTTTATAGCTGAGCTCAATCTTTTTGTCTTGGGTTGAAGCCGAATTGTCTGCTCCTGAAAGGTTATTAAATCGAGCCAGCTACCAACATTGTG
TGGGTTAGCTGTAACAGCAGTGTTGAGGAATTTGCTGCGTTCCACTAGATGTTGCTCCACGCTTTGCCCGTCAGTGAGAAGAATTCCGTTCGTGTCATCA
TTGGCACGAGAGAAACCATCGTACACCTCACCCATATCGCCCACATCGAGTACCGGATCAAGCGGAATATACGTCATTTCAGGTAGACGGTGGTCAGGTT
GATTCATGACGTCTTTAGCTGCTACACGAGACAATCTTTTCTCCGAATAGGCGAGATACAGACGCTTCTGTCGAGCATTTCTCTCTAATTTGCGTGCCTG
GGGCGAAAAGTATCGACCTGTGTCTTGGCTGTTCTTCTCCTTGCCAGATCCTTCACTACTGATATATTTTGGCCATGCTTGGGATATCCATGCACCGGTA
TGCAGGTTCCGTTTCGTAGCCAACTCGTACAGTGGCTGGTCGTGGACATACGTCGATCCGAAGAACTGGTTCTCGCGATCACCTACACAGTCGAATTCAA
AGAGTTTTTCGCTCTCTTTTCCTGCATTTTGACCGCAGACAGCAACATCTTTGGCAGTTTGTTTCGCGATCCGAGTCTCCTTATGACAGCGCAACTGGGA
GCGCGACCGAGAGTTGCTGCGGCTACGATGCCGTCGTCGTCGAGAGCGATGACTAGAGCGACGCCTTTCTTCGTCATCGTCACTACTGTTGGAGCGACTC
CACGACCTGCGCCGTTTCTTGTCTTTGCTCTTCTTCTTGAGGTGGCGACTCTCGCGCGATGCCACGGCCGTCGACTCCTCGCTGCGTCGCTTCTTCTCCT
TGTACCTCTTCTTCTCTTTGTGGCGATGTTTATTATGACGATGTTTGGAAACTTGCAACGCAGACTCGGATTCTGCAGCATCGTGCTTGGTCTTTGAAGG
ATCTTCACTTTTACCACCGGAAAAGCTCTTTCCAACGCTCAGCCAATCTAGGAAGAGGGACACACAGTATTAGCGCATTACTTCTGTCACACCTTAAGAC
CCACGTATACTGCCTACCATTGGCGTTACTTCCAGCGTCTGCATCGGCATCGGGACTTGCCAGCTTCCGCCCTGCTGCGAACATGATGCGCAAAATACCC
AATTGGACTATTTTCTGGACAATAAATGTGTATCGAGCTATATATTTTTGGAAATATGGTCCAATGTTTATACCAAAAACAATGAGCTGCGAGAAGCCCG
CAATGCTGTCGCCGCCTGCGGACCTAACCGACGAGGAGGAAGTCTCCGCTTATATTAAGGAGAAAATTTGTGTGTATAGCAATTTTCCCAAGCCTGGTGC
GGACTTTAGCGACGTCACTTCGCTTCTGTTGGACCCTATTGCCTTCCAGGTTGCCATCGACGCGCTCAAGTTGCGGTATGCGGACAAGGGCATCACACAC
GTAGTTAGTACCGAATCGAGAGGGTTTATCTTTGGGGCACCATTAGCGCTGGCTCTACAGGCCGCTTTTGTGCCAGTGCGTCGCGCTCGGCGACTACCAG
GAGACGTCGTCGGCGTGGATTATGTGTCGGGATATTACAGCGGTCGGATGGAGGTTCACCTGGACGCCATCCCCAACGGAGGACGTGTTGTCATCATCGA
CGATTTGGTTGCATCTGTACGATAGATTTGTGCTCTTGTGCTATGATATTTCAGCAGTCGATAATGCCTCATTGTTGCTGACAACAACCTGCTGCTACGC
AGGGCAAAACGCTTAAGGTGACGGTCGAGCTCGTCGAAAATCTCGGTGGAGAGGTAGTAGAGTGCGGATGCGTGATCAATTCGCTGCATTCGACGGTGTG
TTTCCTGTGTCTATCTTGCTAAAATGCTACTGGTACTACATGTAGAACTGACCATGCCTTCATGCAATGCTCTACAGGAATTGCTGGAGAACATACCGTT
GTACGGCCTCACGACGATATGACCGTCTTTTTAGAAATGTATGTGGCGCTATACGACCACATGCGAGGCAAGATCGATAAGGCAAAGAGTCTTTGCTTTG
CCAAAGACAATTTCGGTCTTCTGCGCTGTCGAACCGAGTGACCGCACTACATGTACACGACTCGTAATTCACCAGTCGTGAACATTCATAGACTCGCAGT
CGCGTGCAGTGGATCGTTGACCTTTATTGAAATGTGAAGTATCAGTTTTTATTTTGCTGCTGAGCTGAGCGCAGTGAGTTCCATGCCAAAGAGTTTCATG
CTAGGAGTAAGTTACTACTGCGCTTGCGAACGATCGAAGTACAGTAGGCTCTGGCACAACTTTGTCCTTGTGGCCTCGGTATCGCCAGTTTCGGCATCCC
ACATTGGGTTACGGTATGCAAACCTGTTGAGCCTGAATTATTGATACTGTTTAAGGCAATATTTGCATTTGATAGAATTTTACTGAGCACTGTCAAAAGT
ATACAATAAATTTTGATGACCCCAGTTTTGGACCTTCAAAGCGTTGGAATCAAAAACCGAAAAAACCGCGAAAGAGAAGAAGCTACTGCCTGCTCGGAAC
ATGCCGCCTAAGCAGCGAACCCGCCAGCGCTTTGGACCCGGTCAGGATTACCTACTGGCCGTGCAGGTGAACACGGACCAGCCGTTCCGCGCGCCATACG
GCGGGCTCATGGCCGGCTGGGAGAAGATCGCAACGACCCTCAACGGCAGTAGCGCCTTCAATATGCACCACCTCAAGGGTCCCATCGCCAAGAACCGCTT
CGAGCGTCTAGTGGAGCGCCACCGCATCTGGGTCCAGAATGGCAGTCACCCAGACGACGCGCCGTCGCAGGACGAATCTTTCCAGAGTGTCATGGCCGAG
GTGATACCCAAGCTGGAAGCTGCTGAGAAGGAGCCGCAGGCCCAGACATTGGGCAAGCGCGGCCGCCCGCGTAAGATCCGGTCGGAGGACGGTGAGGCTC
CTGCCGAAAAGAAGCCGACATCGGCGTCTGCGCAGGTGAGCATCGCTCCGTCCCCATTGAGGGCCCAGCCGCCGTCCACCTCTCTCCTGGTGGATTCCGA
GGATCAGGTGCTGCCCACTGCCACCAAGGCCACCCGCCAACGGTTCACTCCTGGAGATGACCTTTTGCTCGTAAAGCTCGTGAAGGAGACGCTGCCATTT
CGTGCCAAGTTCGGCGCCATCTCGGCGGCATGGGACGATGTGGCGACTAAGCTGGACAACAGCCCCGAGTTCTCCAAGGACAATATCAAGGGCCCCATTG
TGCGCTACCGCTTTGAAAACCTCGTGTCCAAGTACCGTGAACGCGTCAAACGCAATAACGGTCGTGTGGTGGGACCGAAGGGTGTCCCTGCAGGTGAACT
TGAAGTGCTTCTGACGGAGATGGTGACGCTACTGGACGGTGGCGACCCTGTCAGCGCTGCGTTGCTTGCGCAGAACGTGGCAATCGCCACTGGCGCGAAC
GATGCAACTTCTCGGGAAGCCCCTCGTGCTGCAACAAGCCAGGATGAGGATTCTGCCAGTAGCACGCCAAGCGAGTCGTCATCACCGACCCCCACGCTGT
CCCAGAGCTTCATCGCCCCTGTGGTTCAATCATCGAAGGCGCAAAAATTGACGGCGAAAAGCGTCGCACCGCTGAGTGGCGTGGACTTAACCAGCATTGC
TGAGCTCAAGACGCTACTCCAGGAAATGGTGGAGCAACAAGCTCGGGCCACGGAGCAGTTGCTGCTCCTGCAGCGTGAAGAACGCCGCCTGGAGACCGAG
CGACGAGAGCAGGCGTTGGAAAGCGAGCGTGAGGAGCTCGAGAAGGACCGCCAAGCGCTAACTTCTGTCGTGGTTTCGGTCATGAAGACGTTCCTCGAGG
AGAACGGGCGCAAGAACTGAGACCAGTTGGTAGTTCATTTAAGGGTACTGTCGTTTAGCATTGTCTCTGTAGGGCCAGCGCCTTGCTGACGCTTGTTAAG
TCCATTAAGTTCATGCGAACGTCTCGGACACTACATCGCGTTCAACTTTAAAGTTGCAGCTGATGATTTGCCATTGCTGTTGGCCAATTTCAGGATCACG
TTTTTCCTAGAGGACTACACTTCTAAAGAGTGTCTCTATTACACAAAGAAGTGTGAACTGACCATGCCCGATGATGCAGGCTCATGCTTCGCAAGCACTT
GGTGTGCGAGCTGCTGCGCCGGCGGAGGAACCTCTGCAGACGACACCAATCGTCGACGCCTCGCCGAAGACGATCCTCGCCGCCGAGACTACGAAACATC
ACGCAACGTGACCGTACAGCCCGTGGTGATGTCCCAGATCCGCCCGCCGCAGCCCCAAATGCGCACAAACGCTTAGAGCGCGAAGAAAGGGGCGACACTG
ATGTACTTCGTCTTGTAGCCGGCATGGACGAACTTGAAGTAGAAGGCGGCTTGCCCGAATTGCTTACGAGCCATCGCAGGAGCAGAGCATCAGTGGATAA
TGAATATATTGCATTGCCAGTAGCGTCCTTAAGCAGCAGCGATATCCAGTTGCATGCTGTTCCGCCGGCGATTATGACACGATCGGTGTGGGTTAAACTT
CACAGATTCGATGCGTTTTGGTGTTGTTTGCTGAGACACAACCGACTTTCCCCTACAATTATCAAGTGCACACAAGTCGCAGTCTTGGTAAAAAAAGTTA
GCTGCACACTGCAATTCTCATTGCGAGAATTACCAGCAGAAGAGCAAGCGCAAGAAGCTCACGAGAAATCAAGGAACTTTCGAGTGACAACAACCTCGAG
ACAACTATGTGCTGCCCTGATGGCGACGATTGCTGTGCGTGTCTAGCTGGCATGTGTTGCGCCTCGTGCTGTCTTTCGGCAGCCTCTGCGGGAGACAATG
ACCGTAGGGATCAACGTGACTATGATTCACGCTCCCCGAAACAAGTGTACGTTCAACCAGTGGTTGTGCAACAAGGCTACGAGTACCAGCCGCAGGGTTA
TGGACCGCCGCAAGGCTACGGACCGCCGCCTCCAGGATATGGACCTCCGCCCCCGCATCGCGACTACTACTA