Description :
From Genome Similarity Track
Location :
Scaffold_66:1334- 5858
Transcript NameFunction/comments
Phypa_INRA-310PPTG_17327hypothetical protein
Phypa_INRA-310PPTG_17328hypothetical protein

Sequence
4524 bases(100 bases per row)
TCAAGATCGATGCCCTCCGAATCAAGATCGACAAAAGATCCGTGATCATCCAGGAGACCGACACTCAAGATCAAAGGACTTGGGGACGGTGGCCAAACGC
TGATCGCACTGCGGATCGAAGAAGCATGGCGATCTTGGCTGCTGGGGGCGCTTGAAGTGCGGGAAATGTGAGCGCAGAGGCCACCCGACGGACCGATGTT
TTCTCGTTTGCAAGGCTTGCGGAGAGATTCATGAAGCTGGGGAGTGTCCAATGGAAGAATTCTACAACCTGATTCGTCAATGGTTCAACCCTGACAAGCA
TCGAGGGATGTTGCCAGAACCTGCGAAAAGGATGTTAAACTAGAACGATCGCCGGGTTGGAATCCGGTAAGAGCCGAGCGTTCTAGATTTTGCATTTATG
CATATGTCGAGAAACAACCGAAGTTATCGGTTAGCAAGCCGATGACCTCTATCGACAATACATGCGATCTTCAAAAGAACCATACCTTTGCCGTGTCAAG
TCTGCGTGAGCACGGCGAATTTTCGAGGTCGCCCGTTGTAATGACCCTGGACGTCTTGCCTGGAGAGTCGCGTGGATACTGGAAGTACCTCGCACCAGAC
AAACGTTTCAAGCAAGCAAAAGCAATGGGGAAGATCAACAACGAGAAGGCGCTCTTGTTGTTGGATAGCGGCGCCGAGGTGTCAATTTTAGATGCCGCCT
TGCTTGTATAGTTGGCTGCTATATTGACAAAAGTCAGACACTAGAGTGTGAAGGTGTTGGAAATTCTCCGTATGCAATGCAAGGACGTACACGAATCAAG
ATCACATTGGCTGGAAACTTGGTGTATTTGTTCGACGTCTGGGTGGGCCCGCCGACTGGTGGTCAAGATCTGATCCTAGGCATGGACTTCATGGTCCCTG
CAGGGATTCGGCTCGATCTTGCAGACGGCACGTATTGCCTCCCTGACGAAGTTCGGATACATATGTATGGACGGCGGCCGCCCTACGGAGAGAAGATCGA
CAAGATCGAGGTCCGTGAAACCCGTAGAATTGGTCCTTGGCGATCAGCTGAGATACCGCTACGCCAGCGATCTTGCGATCTCATGAAGCTGTGGGTTACG
CGAGGCGACCGCTGGGTCCCTACCTTCGTGCTGGGTCCGGGCAAGAAGTGTTATCTGAAGATCACCAATGTTAGTGACCGTGTAGTATGGCTGCAAGAGC
ACGATCAAATTAGATGTGATTAGCTGAAGTACCGCGCTTACCGGGATATGTCCTGGTCGGGTCGAGACGCTACGCGCACTGGCAAAATCTGGCGTATCAG
CTGCGGCTGACGAGATTGACGACGCGCCCGAGGTGATAGCCCTACCAGGACCCGCTGTAGAACAACCGTCATACGCCACGCCGACCAGAATTCTGCCCAG
ACCAAAAGCGACCTCTCCTGGATCGATGGCGACCTCGCCCGAGTCGCCGAAACCTCTCCCTAGTATGGGGAAGACTATATCCGCGGTGACGGTGTGCGAC
CGCTGTGCGACAAGGCGGCGAAGAACACAGACGAAGCCAATCGAAAGAACACATTTGATGCCAGCTGCAGTTCATTGACCGGGTGGCAGACGACACGGCG
TGTCACACGCGGGATGAGTCCGCCCCATCCCGTGATCAAGAATTTTCTGCGGGATGCGACAGTGCAACTAAGATGCGTGATCGACTCACTGAGACAGGCC
CGAGTCAGATTCGTACTGAAAATGAGACGGGGTCACTTCTGATTGGTAATCAAGATCGACGCGAAGAGACGAGTTTCGGTCAAGATCGACGTGCAAAGAC
AAGTTATGACCAAGATCGACGGATGTGTGTTGAGCAAGATCGACAAAAAGGCACATGCGCTAGACAAGATCTTCAGGTGGAGGCAGAGACATTTTGGACC
CGTAATTAAGATTGTGGAGCAGCGCCTGATTTTGGAGACGAGGAAGTGTGTATCAGCGAAGGAGGCGACCTCTAAACAAATAAAACGCGGAATATGTCAG
CGATATCATGGCAGTCCTTCCTGATGTCGCTGATCTGACGGAGGAGGTGAAAATAGAGGATATACAAATAGGAGATCCAGATTACAACACACCAGAGGCA
TTCAACAGATTGAGGCTAATCCTCTGGCGGCGTCGCCACCTCCAGATCGGAAAGGGTAACGCCTTACCGCCAGCTGCAGTAGGTGTCGTATGCGACATAG
ATGTGAGAAACGTCAAACCCGTGGCCCAGCGAGTCCGAAAAGTCGCCCCATTTCAGCGCTTATCACGCCTTTGGACTATTTGAGTGAAAGCTTGTCCTGT
TAGGCCTCAAGAACGCTCTTCAGATCTACCAGCGACTGCTAGACAACGCCCTATACGGTTTCCTTTAGATCACGGATAACCAAGATCGTGCCGACAAGTC
TGACGTATTTGAAAATGGAGAACCCGATCGGTGTAAAACGTCCTCAGTTCTTAGACGTCGATCTTGTATTGATGACATCCTTGTGACGGCGAGATCGTGG
GACGGGCTGTGTGAGAAGGTAGACAAGCTTGTGGACGTGTGTGATGAGTGGAATTTGTCCATCAGCGTGGCGAAGAGTGTCTGGGGACGGCACAAGGTCG
ACTATCTTGGCCATTCTGTTTCCGCAGACGGACTTGAAGCCACGCCGAAGGACCTGTCTGTTCTGACTGACCTTCCTTCCCGATCACAATGAGATCGATG
CAGTCTTTCCTGGGAAGTTTGAATTACTACATTCGTTTTATCGAGGATTTGGCGATTTATGCTTCGATACTCTATGAGTTTCGGGAAGCGGATTTCTTAA
GATCGCTCAGAAGTTCAAAATCGAAGCTGTAGCTGGACGATAGTAATCCTGAAGGATATGGCAAATGGGCCAGGGCGGTCAGGACTTTCGAAACGCTGAA
GGCCAGGATCGCGACCGGGCTTATTATTCGGCATATTGACTCCGACAAACAGCCCGTCGTGGTTGGGTACGCCAGTAAGTGGGCGATCTCAGCAGCCTTG
GTGATGGTATGTACCAGCCTGTGACCTTTACATGCCGAACGTTTAAGCCGGACGAGATCAACTACTGAATTGTGGATAAAGAGGTATTGGCGATTCTAAG
AATCGTTGATGTTTGATAGGCTCAATTGGTGACAAGGTCGATCAAAGTGTTGACTCGACATTTGACGTTGGGTTAGCTGTTGCATTCGTCAGGTCTACAA
GGAATACTAGGAAATTGGGCTGCCCTTCTATCGAGCTGGACGCTAGAGATCGTAAAGTGTTTTAAAGGCGAGGATGAAATCTTGGGAGTGATCTCAGCTA
GCTTCACCCCACTTGCCGAGATGGACGCGATCTTGACGTCGATTGCACCAAGAAATCAGCCGAGGTAAGTCATCACGATGCAGCCGCCCACTGTTGAACC
AGATGAGATGTTGCTGGTAGTTAGTTTCGATGGATTGGATCGTGTGAAACGCAGTGGAGGTGTATATAGCGCGATCGTATGGAGCTTACCTAAATGGACT
GTGGTCTCTGCGGGGTCCGAGCATAAGAATCTTACCATCAATGAGGCAGAGTACCACAGTTTACTACTCGGTTTTAAGCTCGCGTCCGACCTTGACAGAG
GACGGCTTGTTATTTGTGGCGACTCGAACCTAGTGATTCGGTAGATGCGTGGGGAGATTGAATGTATGGCGCCGAGTCTGAAATTACTCAGACAGAAAGT
CATGGAGCAGTTGCGATTTTGGCCAGAACATGAATTTCCCCATGTGAAAAGAGACTGGAACCAAAGTGCTGACAGCCTCGCTCGTGCGGCATTGCAAAAG
GGAGAAGGCTCCGTGACCATGTCTGGGGTTGGGAGTAACGATTTGATAATGCTCAACCGCCTGCCGGAGTTGTTGGTCCCTCGATCTGACGAGGCAGTGA
CCAAGATCGCAGCCGTCGCAAGATCGTACCGGCGACGCAGGGCTAAAGTGCTACAGGAAGCCGTTGTACAGCGGATACGGATGGATCGAATTGTTCGAGC
CCTAGGTGAGGAGAAGTGGGCTACGGACCTCAAGAGGTATTTGCGAGGGACGTGCAGGATCTGACAGCGTCGGACGCTAAAACTTGTGCCAAGATCGCAG
AAGACTACGAGATCGACGAGGCCGGCCTACTCTTCTACTGTCCTCCATCCAAACGAGCTGATGAAGATCGCGACCTCGTGATGAGGTTAGTGGTACCAGA
ATCGTTACAAAACGACTTTCTTCACCACTACCACACCAGCCTGAAGGGTGGGCACCAAGGTATCGGAAGAACCTACCAGCGCATTCGGGCACACTTTCAC
TGGAGAGGGTTATACCAGAGTGTCCAGCTCTATGTGGGACAGTGTGTAGAGTGCGAGACTGGGAAAGGAAGGCCGACGATCCAAGGTGAATCACCTGGTA
ATCTTCAAGCTACCTACCGTTTCCAGATTATTGCTATGGACCATGTTCCGTCGATGTTTAAGTCGTACAAGGACAACACGGAGTTGCTGATCTGGGTGGA
TCTCTTCACAGGGTTCGTGGTCGC