Description :
From Genome Similarity Track
Location :
Scaffold_118:1334- 3822
Transcript NameFunction/comments
Phypl_g3522hypothetical protein PITG_02323
Phypl_g3523hypothetical protein

Sequence
2488 bases(100 bases per row)
ACTGGGCACTATTACCGATTAACTTCCTCTAGTCCAGCTGTACCCATGAAATTGCCTCGTACTTAGTCGCAACTCATGGCGGACCGAAATGTTCGGGCCG
CACATTTCCGGGCAACAcgctggcggccgacggACGCATACAAACACGGCGAGCGCCAGGCGACCGTAGCTCGATGCCCGCTGTACCTGCATCTCCATCA
GTAGCAATTGCGCCCACCCCTCCACCTAAAGCCGCCAGTAAGAAGCGCACACGACGCCAATGTTCCCATCCCGAGTGCACCAAGGTGGACGCTGGCGGAG
GCTTCTGCGTGGCCCACGGGGGCGGCAAGAAGTGCTCGTTCCCGGGTTGTACCAAGGGTTACCAGACCGGAGGCTTCTGTAGAcgacacggcggcggcgc
gcgctgtcAAGTAGCTGGATGCGGGAAGGTGGACGCTGGCAGGGGACTGTGTCGAGCGCATGGCGGCGGTAAGCGCTGCCAAATCGATGGGTGTCCGAAG
GCTGACGTGGGTGGAGGGTTTTGCACGGCCCATGGGGGTGGCAAGCGCTGCTCCGAGCCAGGATGCACCAAAATCGACCAGGGAGGAGGCAAGTGCCGAG
CGCATGGTGGTGCGAGACGATGTCGGCGACGCAACTGtcagcagccagctcgaGGCGTCACGGGATTCTGCACAGAGCATGGCGGCGCACGTGTGTGCTC
GGTCTTGAGCTGTCGGAGGTTGGTGCGCTCGCCAACTGATACGGGAACCCTGTGTGTGACTTGTGCAAGGGGTCTACAGCAAAGAGGAGCAGGCAAACCC
ACGCAGGTGAAGGCCGACGACAACGCCGCAAACAGTGATCACTCGAACGCCAGTCCGCGAAACAGCGCGATACCATCTCCAGAAGGCTCGGGCGCATCCG
TGTTAGCGTCGTTTCCTCCAATGTCTCCGAATTTAGCAAACGCGCGGTGTGACGGTTCTCAGATTGCCAACTGCTTGGACAATGGCTGCGCGCGTAGCTT
TGGAGGCGACTGTAACTGCGTCAGTGACTGCACGTGCAATAGTCCAACGTCGCTGTCTACGTCGCGAATGGTCCCGATGCTGACGAGTAGCAACACCATC
ACAAGCGTTGCTACAAcaaccagctccagcatcaccGAATTTGAACCCCTTGTACGAAGTATCAGCACATCGACGCCACGAGCAACAATGATGCCACGTT
GTGTGCTTCAGATCAAGGCATATTCCAGTATGACGGGAATCGAGACCATCATAGCGATGCTTACAACAATCTCGGGAGTGAGGAGTGTGCACTTGATTCC
GGATAGCTCTGCACGACCCTCTTCCTCTGAAGCTGAGTCAGAAAGAGTGCAGATGGCAGCTTGCTCCAGTCCTTCTAATGTAGCCCCATCATTACGACTT
GTTGCGGTCCGTGGAGGACAAGCACTAGACTTGGAAAGGTTCTTGGCATCCCTGAAACCCCTCGGGCTTGCCGAGATCAACGTCATTGAACAATCATCCA
TTCCGTGGACCAGAAAAGAAGTGGTGCTGTGTGTGCCTGATATGATGTGTCCTGGAAACTGCGGGTCGTCGGTGCTGAACGCCGTGCGTGGAGTAGAAGG
GGTGGAAGCCGCAAGGCTCCGCTTCGAGCACCGTCAAGTTGTCGTCCGTGGCGATATGAACGTCGATGCCATCCGCACAGCTGTAACGGACATTGGTTTT
GACTCTGAGGTAAATGCTGAGACTCAGCTGCCTCGACGATTTCGGTTCCGTGTTGATGATTTGAGTGACGTGGGGTTAAACGGCGCAAAGCTCAAGGGCG
CTTTAAAGGCTGTGGAAGGTGTGGAAAACCTCGTGCTGTTAACGGATCGTGTCGAAGTTCTGGTGGTAGCAATGCTTTTGGACCCAAGCCCACTTGTGGA
AGCGGCCGAGCGTGTTGGTTTTGATATGCTGGAGCTGTCAGAAGAAGCCTGGGGGATTCCGATGGAGGTTGTGCCGCCGTCTCTTGGATCTTCAAACGAT
GCAGGAGCGAACGCTACACGCGAGTATTATCAGCCTCACAAGTGCGATATGCGCATTTGCCCTCAAAATGGCTGTCCGAGGTACATGACGACGGTAGCGC
ACACGGCGGCGCTAGCGGTTGGTTGGGCCGTACCTGGCTGTGGTATGTCCTCTGGCGGCGAGTGCACTTGCGGTGATAGCTGCAAGTGCGAAGGTTGTCC
GGAGCATAATCCCGTGTCTTGAGCACCAAGTGCAGAACAGGCGATTTCTTCGTTAGCGTGTTGTTTACCATCGTTGAGCTCATCCCGAGAAGTTAAATAT
TTTTCCTCCATGCTGGCACCGCCCTCGGCTGAATTGGTACATGTCCAAAGCTCTTGAACTTAACGTCAGGTATCGCTCGCTTGCCAGGGATGTAAGCGTC
ATGTGCACTTTGGCGTTCTCTCTGTCGTGCCTTTCTTCGAATCTCTTCCTTACTCAGGTCCCGAGCTTTGGAGGCTTCGGTCGCGTTG