Description :
From Genome Similarity Track
Location :
scaffold_22:1333782- 1335121
Sequence
1339 bases(100 bases per row)
GTTTTGTTTATGCACATTTCAGAATTGAAAGTACAAACGCTTGATTGGATATGCTTGGATGCATTTGACCGCCTGTCCAATGTCATTGCTATTTGCTGCT
GATCATTTATCTGCTCAAACGCTGTATGGTTTTGTGCCGCCACTTCAATTTGTAATCGATCAGATCGGTCTCCATTCAATGCGTGTAGCgaagtgaaaag
cttttatACCCGGTCAGAATCGTTTGGCAACGATCTCGCGCTAAACCGAGCACACACTGTCGACCTCGACATTCAAAAGCTCGAGTCAAACTTGTCGCCT
CATGGAAGCTTCACAATCATCGGCGACCCGTCACGTGTTACTCCAGTCGAACGGCGGCGAAGCGTCAGTCACAACACCGTATCAAACATGATGAGGCGCA
GTCGCAACAACATCGAGTTCGGCGCGCTGCTCACGTAGCAAGTTCTGCAGCCTTTCAAGAAGATTACCACGTTATTCAGTGACTCCAGTCGATGGGATAG
TCAAGTTCTTGTTGCACGATATCAAGGTTGACGGAAGCCACTGTAACGGGGCTCCACGTGCCCTGAGTTGAAGGGTCCGtgttacacaagatgttgtgat
cacacaatggtgtgtgtGACACAAGATTGTGTTAACACACAAAGGCGGGACAACAAATCGGAAGCGGACTTTCGTTGCAGGTatagcagccgatcctctt
cccgatgtggtcacagtgactgtctctatggagggccttcgcactggcgaggccagaatggaagtctttcgagTGTGCCCGTCTTCATTTcaaaaagcgg
tgaatgtggcattgaatgccgctTATACTTTGAAACGGCACactttggttggaatgcacactctatcagcttgtcgagcggaCCTGAGCCgatagatctc
agctatgctgaggacgaggaggtagagatccgagctgccgagcagcgttcaagcacccgacggtgttttgtctgtggagacacccgtcacctttgggCTG
GTTGTcttctgcgcaaggcgcgtcaagattcatcgaaccgaccaCTCGATTATTACCATTATGGTTTGTCACGGGGAAacaacaacacccagtaggcgcg
gtgCGGTCTACTAAGCaagaattgagttctgttggGCCTCAAAGAGGGAGAGGGCAGCGgaacccagccccgaagagctccggaacgtgtatgcaagccg
ggcttgcgggtcgtggaagcgaccgtgaagggcttggAGAAGCCAAGGAAGATTcttatcgactccggggcgaCGATCAATTATACTCGACGCTCAAGGA
TATAAGAAAATTAGCTGCATTCTGAGGCGCTGTAAgcac