Description :
From Genome Similarity Track
Location :
Scaffold_307:13334- 16172
Transcript NameFunction/comments
Hyaar_Emoy2813662ribonuclease BN

Sequence
2838 bases(100 bases per row)
CACCGGAAGAAGTCTCGTACTGGTGATACGGCCTAAGGCGACCGACGTAGAACGTAGGACGCGTGCGCATCTTACGTTGCAGTTCAATAGTGTATGCGTT
GCCTAAACGGCGCGGTACACGAAATGGACCGATGAACTTGGGTAGTAACTTGTTACTATCCATGTTAGTCACTATGTGTCGAGGTAGGTTTACCATAGAT
AGTAGGACTAGGTCAACCTTCATTGAATAAAAGAACATTTTCCCTTCCATTCTTGTCTGCGTTTTTCTTTTTAGTCGGTCCACTGCTTCTGCAATGGAAT
CTTGCACGAAACGGACAACCGCTTCGCGAGCCAGTATGAATTCATCTGCTGACTCGCTGTCTTTGACTTTAGTGCGCTTGGAGCGCACTGTGGCAAGATC
AGTGCCCTGAGTAGTAAGAGCATCCTCACTCTAACTTTCCTCTTCTTCACCGAAGTCGATGTGATCGACATCGGCATCATACGTAGTGACCTCGTGGTCA
GTACGTGTTGAGTGAGCACCGAGCTGGCGTTCGCTCGAACGATTACCCCCCCGTCAAACTAGAGTTACAATCAAAAAAGGTGGGTAGGCGTGGGTGGCGC
AAGCCATTTACAAAGAACGGTGTATGCGTCGTCGATGCATGCACCGAGTTGGTGATGGCGAATTCCACTATTGGCAAGAAGTCGCTCCAATTCGTAAACG
AATGGACGTAACCCCGAAGGGTTTCCTTAAGATCGCGGTTGGCACGTTCTGTCCGACCATTTGTTTCAGGGTGGTCAGAGGTCGACATCTGAAAGCGCGT
TCCGAGTGTTTTGAACACGGATCGCCAGAATTCCGCAGTGAACCGTGGGTCTCGGTCGGAGACGAGTTCACGAGGCAACCCATGAAGACGAAAGATCGTG
TCAATAAAAACACGAGCACATGCCGACGCATTGATGGATTCAGGTACGGCGACCAGGTGTACTATTTTACTGAATTGATGAACGAACACAATAATACCTG
TATTCTTGTATGGGTCTCCGGGGGATTCGAAAGACAAAGTCCATTGAGACAGATTCCCAGCATTCCGCCGGAATGGGCAAGGGTTGCAATGGCGCACGAA
GTGAAGGACCAGACTTCACTCGTTGACATACTTCGCATGAGCGGACATACTTACGCACGAACTGATACTGGCGGGACCAGTAAAAGTCGCGACTAACTGT
GAGATATGTCTTCGCTCGACCACGATGCCCACCAGTAGGTGCATCATGGTACTCATACATGATGCGCAGGCGCAGGTCACCATGGTCCGGTACGACGACA
CGAGGCGTGTTGCCGGCAACGGCTGTATACTTCAGTAATCCATTGTGGACTGTATATCTATCCGTGGAGGATCGATATACTGCGGGAAACCTCTTAAGGG
ATTGACGGGATGGTTGCGAGAGATGTTCCATCAAACGCACCATCGCCGGATTGTGCGCCTTGCGTATATCTTTGAATAAGGTTAATGACGGGACACTCGA
CGTCAACACCGCGACAGTGGTCGGACCAGTGTCGGGTTTCGCAGCCGGTTCGAAATTGGGCCGGCACGACAGAGCATCAGCGACGACATTCAGTCGTCCT
GGCTTATATTCCACCAAGAAGTTATACTACGCGAATATCGGCATCCACCTCGCCATTTGCTGCGAGAGGTGTGGACTGTTAACGGCCGTGCGTAAGGACG
CATGGTCCGAGTAGACGATGAAGGGTCTATCACCTAGCATGTAGACCATTAACTTCGCCAAAGCATACTTCATGGCAAGGATTTCCTTGTCATGGACCGG
GTAGTTGCGCTCAGCCGGTTTCAGCTGATGTGGCTGATAGCAGACGACACGCTCTGCATCGTCTGTGTCATACTGCATTAGTGCACATCCGATGAAAAAT
CACTTACATCGCAGACCAGATGAAATGGTCTGTGTTGGTCTGCAATCGCCAAAACTGGCGAGCGTATCAAGCTTTGCTTGATACCTTCGAATGAAGCGCT
GACAATCAGCACTCCATGCCCACTTCTCGTTCTTTTTCGAAAAACGAGAGAGATGGACAGTCATCTCGGCGTAATGGTGCGAGTATTTGTGCAAATACGC
CGCTAGACCAAGGAACTTTCGAAGTTCTTTATTTCGGTAGGCACCGCCCAGTCAGTGATCGCTTTGATGTTTTCTGGAATCGGGCCGGACGCCGTGCTTA
CCCACGATGCATCCAAGAGGTGTTACTTCGCTTGCAGCAAATATACACTTGTTGAGGTTGGCGTATAACTTATGCGCACGCATCAGTGTAAGAACCTTTC
GGACTTGGAGTCGGTGTACTTCCACATCTGTCTGTCCATCCATAGCCCGTCTATGGACGAAAACGTCATCGAAATAGCTAGGTGCGAATTCTCGCACAGA
TATCGACAGATACGTAACGCATCTGTTGAACGTATCAGGGGCATTACTCAGCCCTTGTGGTATTACTAACCACTCCCAAAGCATACCGCTTGGGGTGCTC
ACCGCAGTGTACGGGATGTCACGCATAAGGATCTGATAGAACCCGTCCATTAGATCCATCGAGGAAAAGATGGTACTCTTTGCCATACCATCGATGATTA
CGTCCTTCCTTGGTATCAGAGTTTGAGCCGGTACAGTTGCAGCATTCAACTAGTTGAAGGCATGTACTATCCGTCATCCTCCTGTGGCCTTTCGGACACA
GAAGGTCGGAGAGCTATGTGGGGAAGTAGACTTCCTCACATGGCCCGCTGCAAAGCGATCGGCAAAGAATTTGTTAATCGCTAGTACTTGTTCACGAGGC
AGTGGCCATTGCTTTACGACACAGTGCTTTGAACCTGG