Description :
From Genome Similarity Track
Location :
Scaffold_311:13333- 15247
Transcript NameFunction/comments
Physo_144896reverse transcriptase

Sequence
1914 bases(100 bases per row)
TCATATACAACCCCTTCCTCCGATCAACGGCCTCCCCGTCGATCCGTCATCCCTCTCGCTCACCAAGGTGACCCGCTCACCCTGGTGGCCCGATCTCACT
CCTCCTCGTGAGAGTGCATCGCGCTGAATCGGTTCCGGTACACGCGATCTCGAAGGAACTCGTACAATAACGCTCCGCAGTTGAGATCAGCTTCGTCGAC
CCAGTCAGGCTCGTCGTAACCCTTCCAGCGTACCAGGAACTCTCGATACGTCCGGCCATACCGGGTCCTGCGACCTGTTCTCGTATCCGTGATCTTCTCC
ACTTCGCACTCGTTCGAGTCTCGATCTGGGGCCCAGCTGTCCTCCGGAAGTAAGACTTCGTCGAAATCGAGTCGATCTGCTTCGTCCACCGTGAGTGCGA
TCTGCGGTCGATCGGGGAAGTCCCTGACCAACTTCAGCTTCGAAATATGCACGATCGGGAATAGGTGATAGTCCGTACCAGCGATCTGAAGATTCATCGT
GTACTCGTTCATCTTCTCCGCAACACGGAACGGGCCGTGCCACAGGTGGGCCAACTTCCGGGCATACCCCTCTTTCACTCGATCCAGGTACAGCCACACC
TGAGATCCAGCTTCGATCGAGTGCGGTCGAACTTCTTCATTGTGTCGATCGGCCCGATCCGCGATCGCCTCGCGTAGTCGAGCATTCACCTGACTTCGTG
CCTGATCGTAGTGCTTCTGGATCCGATATCGCCACCGTCGAGGATCCCGATCCCGAGTCCGGGTACTACCCAAAGGTATCGTTGCCTCGAGCGTCGATCG
AGGATCCCATCCATGCACCAGATAAAATGGGGAGTCCCCCCGGACCCGATCCTGAGCCGTGTTGATCGCGAAGGTCAATCGCTCTGCGTACTCATCCCAA
TCCCTCTGATCCAGATCCTCCACGAACATCTTCAGGGCCCTCGTCGCCGTCTGTACCATTCGCTCTGCAGTACCGTTAGACTGAGGTCGATATACCATCG
TCGCTCGCTGGCGCATACCCAGGATCTTGTTAATGGCGCGGAAGAAGTCATCCATAAATCCCGGCTATCGATCGTGCCTGATCACCTCGCTAGCACCAAA
TCACCGGAACACACACTCTTCGTAAGATTCGGCGATCGTCTGCGCCGTTCGGGAGGAACTGGCCTTCGCGATCACGTATCCCGTGAACAAATCGCCCCAG
ATCAACAGTTCCGTATTACCCTTGTACGACTTGGGTAGCGAAGGTATGTGATCCATCGCTATGATCTGGAATGGGTATGTCGCCTGAATGTTTCCCGGCG
ACTCGCCCCTGATCGTGGGTCGTCCTTTGCCGGTCTCGCAGTCGACACATTCGCCGACGTACTTCTGCACACTTCTCAAGAGACCTCTCCAGTGAAAGTG
ATCGCGGATCCGCTGGTATGTACGCCCGATCCCCTGGTGTCCACCTTCCAGAGTGGAGTGATAGTGATGCAGGATGTCTTGATGCAGCGTCTCCGGTGCC
ACCAGTCTCATCAGTCCATCTCGATCTGCATCCGATCGCTTGGAGGGTGGGCAATAGAACAGCAGATTATCACCGTCGATCTCGTAGTCCGCTGCGAGGT
TGCCATAGGATCGGGCCTCATCCTGTGTCAGATCAGCCACATCTCCCCTCAGATATTTCTTCATACCCGCGATCCACGTTTCTTCATCCTGTGCTCGACG
AATCCGGTCGATCCGCAACCCTCCTCCTGCATGACGATCGGGTTCGGCCGTGATCTGGTGCCCGATCGGGTCGTCATCGGCGATAGTCGGGCGATCGACT
CATCCGACCGGGCGACCAGGATCTCATCAAGTCGGTTCAGTGTCACAAGATCCCCATGATCGGCATCCTCCTCGACGACGATGCCCCCTTCACGTTGGAG
TGCTGCACTGTCCA