Description :
From Genome Similarity Track
Location :
contig_60:133314- 157847
Transcript NameFunction/comments
g11162.t1RAW43616.1 tRNA wybutosine-synthesizing protein 2/3/4 [Phytophthora cactorum
g11163.t1hypothetical protein
g11164.t1XP_009515939.1 hypothetical protein PHYSODRAFT_474162 [Phytophthora sojae
g11165.t1XP_009515938.1 hypothetical protein PHYSODRAFT_470887 [Phytophthora sojae
g11166.t1hypothetical protein
g11167.t1XP_009515936.1 hypothetical protein PHYSODRAFT_552372 [Phytophthora sojae
g11168.t1hypothetical protein

Sequence
24533 bases(100 bases per row)
TAGGCCAGCTAAATGGGAACGCAGTGAACGTCAGCAACAAGATGATACACTTTTGGGGCGTACGACTTGACCTTCTCCACGTGCTCGCACGTGATGGTCC
ATTGCTTATCGTACTGCTGAGCAAGTTCGCGCATCGTATCCACCACACGTTGTTCCCACGCTTCGCGATCCTCCACAGCCACGTTGTCGTGTACGTGGAA
CCAGCCACCGCTGGGCTTCAGCACTTGCACAGCCAATGGCCAAGCCTTCTCACTCGTAGGCAATAGTCCCAGGTTCACACGGTCTGCCACGGCTCCGATC
GTAGGGGCCGACTCGCTGTTGTCACCGAGGTACACCTTGCACCTATCTGCAACATGGTTGCGCTCCAAGTTGAAGCGCAGAGCTGCCACTGAGTTCGGAT
TCCACTCGCAAGCGTGGACAAACGCAGCGCCTCCGTGCACAAGAAAAGGTAGAACGTAGTAACCAATGCCACAGAAGAGGTCCACGATCGTTTCCCCACG
GCACCCGATGGTTGCCATGCGAGCCTTTTCGGTGACGTTGCCAGATGAAAACATAACTCGCGTAAGATCCCAGCCATAGACGATTCCGTTCTCACGAATC
TCCACCCAGCCCGGGGCCTCTTTGCTGCGTTGAGAGGTAAGAGCCTTTTGATTTATGTACAGCAGCTCCACGTGACTTTGACGCTTTTCACTCGCATCAA
TGAAGGCCTTGCGTGCAACACGAGAGAATGCAGGCGAGGTGGACGCACAAACGTGTGCCCACATTTCGTATGCGAATGGTGCCCACTCTGGCTCCAAGAA
GGAATCACGAGGGATCAGCAAGACGTCGCTCACGAACTCGTACTTCTCTGGAATGGCCTTCACAACCTTGGCAGGGAGTCGATACTTGCTGGCAAATGCG
CCGATCATACTGCGGATCGCCTCGTTGCGGTTCAGCCCACTGGTCTTTCCAAACTTGTTTGCGTACGCATCGTCATCTTTCACTACCTCAAGCCTTTGCA
GTCCAGTCTCATCCGTCGAGGCAAGCAGCTCACGAATAGCTGGCGTGACAGGAAGAAGGAACACAGTCGTTGGCTTGCCTTCGCCCATAACCTGGCTCGA
TTGTGCAGGCGTTGCAACATGAACACGCCGGGACTTGTCGTACACCTGTGCCCTCTCCAACAAAGTCTTCACCTTCTTCACTTCTAATTTTCCAACGAGA
ACACCTAGCGGCTTGTCATCCGAAGTGGGCAGCACGCTTGTAGAAGGATATTCGCTGAGCTGGCCTTGACATGTGACAGCGGTAATTTTAGGGGCCGCCA
ACGACAAGTGACACTGAAACACCGAAGAGTAGAATTGGCCGAAGCCAAAGCATTGGAAGCCACCGCCTAAAATGTAAAGCGATTTGTTGCTCGGAATCCA
AGTGGTGCTGTGTCCCACAAAAGCAGCATTTTCATGCTTCAGTTCTCCCAGCTCCGTCCACTGCGAAGCCTCGACATCCAGTTTATACACTTTTCGAGTC
GCCTTGTCACCATTTGCAAGCAGAGCTGCAGTCATGCCGCCTACCACAATGACTGAGTGATCGCTAATTGAGGTAGCGCTAGCTGCAAAAAGCGCTGGCG
GCTGGCTTTTGTTACTGCCGTTCTCGAGAACCTTGCGTTCCCAAGTCTCCCCGACAGTATCGAAAAGCATGCACACAGCGCTATCGTCACCACTCTCGCC
GCTGCCATCCACGCCATCCAATGATGACATGCCTCCCCAGAAGACAAGCTTCGTCGAGCTGACAGCCACACCAACGTGATCAAAGCGGCGCGGGATGCTG
GACGTACTCTCTGCAGACAGAGAATAATAAATATTTAGTACACTCCGAAAAAATGGAGTAGGCTTGGAGTTTGGCTTACCGATTCGACGCCATTGCGGCG
AGTTCTGACTGAGATCTAAAGAAAATAGATCTCCGAAAACTCGTTCAGCATCGCGGCCACCGTACACGTACACAACAGAGCGAACTGCAGTCACACCAAC
ACCAAGCATGGACAGAGGTTAGAGCACTTTGTGATTCCAATTCGTCAAGTAAGAGCTTACCAGCACAGCTGCTGTGCTTCCAACGCGGAGAGGGGCAGAC
TCCTCGCGGATGAATCTGCTCCCACAGCTTGGTCTCAATATCCAACGCATACAGGTCGCCCAGGGGTTTCGCGGGGCTGGCACGACCACCAAATATGATC
ATGCGCGTTCCTACAACAACAGCGGAATGGTGCATCCGAGCTGATGGACCAGTAGCTCCAGCGGCAGCGTGGTACGTTTGCTTAAGAGAACCGTCACTTG
ATGGTGCCAGAATTGTCACGTCCGCAATGCGCGTCGTCGTTCCTGACGCAGTCGGTCCCTGTCCACCGAACACAATAATGTTGTCCTGATACTGCACACT
CGTATGCCCCACAAGCTTGACGCCGTCCTCGTTCGTCACCTCCGTCCAGGACCTCAGTTCAACTGAAGAACCACTCCCAACTTGCTTGCTCACTGTCGGC
TGGCAAAACTTCGCGAGGAAGGCGTCAAACAGTCGGTCCGTCTTCTGCTTATTCGCCTCAAACTTCTGGTTCGCGACATCCACGATCCATTGGAGGTACT
CCTCGTCCACCAGCAACTGCTGCGCACTGCGTCCAAGCGGAATCTCTAATCCGTTCGCGGTTGTGCGAATCGCGCACATAATTTTCCGGTTACCAAGCAC
GACCCCCGATTCGCGGAATCCGCTGGCGATGCCCCACTGCAGCAACTCCTTGGCCGCATCCAGGTCGCGACACACCACGTGCATGATGAACGGCTCGTGC
TTGAAAATAACCTGCAAAAGGCACAACAACCATCAGCTCAACACCATAAAAACAACCTAAAAGAGTAAAAATCGTCAAGTGTCAACCATGTTGCTGGTGC
TGGAATTGGCGTCGGGTGACTGCAGCGCCGCCTTCAGTTGGTCGAATGTGATGGTACTATGTTCGGCGATCAACCACTTGCCGCCTTTGGTGATCAGGTC
CGTCGTCGCTTCATTCCCATTGCCCGTGGCCGCTTCACCGCAGAAAACTGCAATTCGCCCCGAACACGAGCTGCTCGTCACCTGTAGCAACATGAAGAAC
CCTATAAATGAGCCCAATTTCCAATTGCAATTGCACCAAGAATGATCACTCACGTAATTCGGGTGGTCGTTGATACTCTTGATCATGTCCACAATGGGCT
CGTCAATGCAGCCCTTGGGGCTCTTGTCCTCCATCGCCTGCAGCTTGCGCAGACTCTCGCGCTTGAGCTGCGCGAACATCGTCCAGCCAGCCACAAAATG
ACCGTCACAAAACCGTCATCGAATTTATTTTCCTAAGTACGTATCAGAATTTCCATTTTGAGTATCTACTCAAAAACTTTCCCTGCATCATGGCCGAGCC
GCGTCTCCGCGTGCGTTGCGCCGGCGTGCGCATGAACCAGCGCGGCATGTCCGACAGCGGGCACGTGTTCTTCAGCGAGACGCAGTACGCGCGGTCCCCG
TTTCTCGTGCGCGTGAGCTTCGACAGCGTCGCCTTCGTGCACCGCGGGACGCACGTCGTGGAGCGTCGCTTCGACTTCCCGACGCGCGTTTTGCACGCAG
TGCTGGCGGACTTCTCGCCGCAGGTCCTTAACAATACAATTCACCAGTATGCAGGTGCGTCGCTGCCCCCAAAAGCGCGGAATTCGCCGCTCCATCCCCG
GACGCACCCGCACCTGTGCGTTTTGGTGCGCTCCGACTGCTTAAACATCTACACTGCAGCCGGACAAGTGTTCGAGGTGGCGCTGCCCTTCCAGGCCAAT
AGACTTTTCCCTATGGAAGGCCGTGGACTGCTGCTACAGCGCAGTCCGGCGGCACAGATCCCGCCCACGGCTTCGAAGCGTCCGCGAGACGCGGCGGCGG
CGGCTCTGGCCAAAAAGAACCGGCGAGCGAGCACCAGTAACAGAGGAGATGGAGACAGGTACAAGTACAGTGCTGAAGACGATGGTACGCCTGCGAGACC
AAGGTATTTTACGCTCAGACACCCGCTGGATGAGGTCAAGCCAGTGGCGAGCAAGAGTGAGGAGGAGTTTCTGGCGAGCTCCGCGTTAGAAGCCGTTGCA
GTGTTGGTGGAAGGAGCGTCTCTTGTTTTAGTGGCTTTTCATCGCTGGGAGCAGAGGTTTTGCATGTTTCGACTGAGTGAGGTGGAGAGGAGTGGAAGGG
ATCAATTGATGCCGGAGGTGCGGGTGGTTGATGGACCCACGTGGACGAGATACCGTGCTAGGATGGATTTGGAGGAAATACGGGTGCCGATTGAACCCGA
GTGGCTCGCGACGCCCGTGTGGAAATCTCCTCGAGTGGGACCCGCGACGTCAAAGCCGAGGTTTCTGTCCTCGATTATTTCTCCGCCAGCGGCTTCACCT
GCACCGCCGTCGCCATTGACGGCTACTCCGTCGGTTTCGTCAAGGAGTGATTCGAAAGTGGCTTTCATTGCGTCCGGTGTTGATGGCTGCCCTTTGCTCT
GTATGATGGACAAAGGGGTTGGAACGCTTCTTTTGAAGCCAATCTCGCAGCAAGAAACTGGTACTGCGATGCTGGCTGAAGGTGACGGTGAAGCTGGTGG
TGTTCGTATATTACACTGCCGTGACGCTGTTCCGATCTGTCAGCATGCAAGGCGATTTGAAGGTGGAGAACGTTCCACAGACAATATTCCAGGTTCCACC
GATATTGTAGTTCTAGAAAAGGATGGCACGCTGATGTTATATCGAGCACACCGTCCTGTTTGTCGCCTCGATCTTCCTGCTGTGGAACAGGATTGCTTCG
TTGGCAGTGCTGCAAAAGATGGGGCTTCGGAAATAGTACGGCTGATGGGCAATGTTCAGCTAAGCTCAATTGACCGAGGACATGCGTACGAGCTCGTGTA
TCCGAATTTACGCAGCAGCAAGAGCGGAAAGATTTGGCGGTGCGAGCACCCGCTGAAGGTTGTGAGCTCTCCTCTTTTGCAGCAGGTTTTCGATGTGCTG
GATTGTATAATCCCACCTACAGAAATGTGCGAGTTTAAAGCACACGTGATTTATCGGGCTCAACAAAAGACTCAAACAAATCGGAAAGATGATCAGCTTG
CAAATGGTGGGGTCGAATGGCAATCTTTTAAGGAGTGCGTCATTAATATGCTGGAGGAAAATGCTGAGGGTAAGCCAGCAGCAGGAGGGACTGGAAACGA
CGAGGAAACGGCAATCTCGTGTTTTGATGCGCTTTGCCAGAGTGAGTTTCATGGCATGTATCAGTACGAGCATGCAATGCTTTTTGCCACGATGGAGCTG
CCCATCGTGGAGTCAACGACAAACAGATCTCCCGAAAAAATGCATACTGACGACATGCGCCAGTGTCAAGCAATGAAGAAATACTGGGAGACAATGTTTG
CGGGGCTTCATTTACTCTGTGAAGACCTGAAGTTGTCGATTACACTTGTTCAGCAACGTCTGCAACTAGTGGACTTGCTGATGGAATGTCGTCACTACTG
CGTTTGGATTCCTTTGCTGCTTATTACAAGAAAGATAACTCTGTGCTGAGACGGCAAGCGAATATGACGATGGAATTTCGATTGCAGGCACCTACGCTTG
GAGAGGGGCTACTTCGCTTTACTTCCTACGGTTGTGTGCCGGACTTGGTTCTGTGGCTACAGAGCAAAATGACTGCGAAATCGCAGAGACTGGCAGCGTT
TCCCATGTTATTGGAGGATGATGATCCGCGGCAGTTTTCTAGAATTTCTCCAGGACGTTTTGTAGGCCCCTTTCGGCGGACAAGAGCAGTTTGTCACGCA
TACGAGCTGATGTTTCCAAGCTCAGAAGAAAACGCGCAGACAAAGGCTTTCAACCTGATCGTTTACCTCAGTCAAGACCCCATCGGTAACGCTCTGTCTC
TGGATGATCTCCCGGTAGGTTTAAGTTTTCCGATCGTGCAAACCATTCGCCACGTGAAGCACCACCCACCCCCTTCCATCACTGAAGACGTGAGCGCATT
TGTGGGGCGAGAGGATCTCAGTATTGCAAGTGCGGAAAGCCTGGCAGATCATGTTGACTATTCGACACAAAACCAGAAACAGCATGATCCAAAGAGTAAA
AGTCTTGATCTCACTGAGGACGACAGTCACGACGACTGCGACGGTCTTGAAGACATTATAAGTCGGAGTCAGCCCCTCTTCCCTACTGACCAGAGAATGA
AGGAGGTTGCACGTTTGCTTCGTTCAAGTCGCCCTCTCTGCCTGAAATTAGAGAAGACGCCGGATTTGTCAGACCTGGACTACGCGCAACAGCAGCAAGC
CCGTTTGTTGCTTCTCTGTAAACGGTCTATGGCGCTGTCTGTGGCGCGTGGCATGGTCACACTAGGCAGTTTTGATGTTTCTGCCGCGCAAACGCAGATA
TGGCGACTTTCTATACCTGCATTGCCTCTAGTGGGTCGTAAACCGCCGGCAAATGCGATTGTGGAGCTCGATCTTTCCGGCTACGCCAAAGAATTGACGT
ATTGGCCTCAATTTCACAACGGCTGTGCTACGGGTCTACGGCTTCCAGCGCATGATCTCTCGGGCGTCGTCAATCGTCATTGGATTAAATACCATCGACC
TTCAGTGAACGATGCTCCACAGCGAAACCCAACGGGAAGTCAGCAGGCAGCAGCGGTCCAGTCGGTTGACTCTGCCGGCCGTAACCTGGAAGAGGCATAC
GCAGCTCATGCAGGGTTATTGCTGGGAATTGGTCTACGCGGTCACCTCAAATGCTTGTCCATGGCAGATGTGTACAACTACCTATCGCTGTCGAATGAAT
TTGTGACTGTGGCGATCATGCTTGGTATGGCTAGTACCGCTGCTCACTGTCGACGCAAGCGAAAGCAGAAGACTGCAGCAGTGAAGCCTACCATGACGGA
CGATGAGCAAGCAAGTGGAGACACGGAGGAACCATCGCTTGGCGCCGATCATCTTTTTTCAGGTTTCCCAGAGCTCTCATCATCCGATAAAACTCCGCTA
CTCGGAACGGGATTAGAACTGGCACTGGAGCGATCAGTATCCAAGGTGTTGTGTCTCCACGTTCCATCGTTGCTACCACCACCATTCGGAGGGTTTTCAG
TACCTGCATCCACTCAGACGGCTGCATTGTTGGGACTCGGCATCTTATATCAAGGCACGGGTTATCGCCTGATGACAGAGTTATTGCTTACGGAGATAGC
GCGTTCTCCATCAAGCGCCCAATTCGCAGGGAACAATGGAAGCGCGGGTCTGTCAACAGGTTCGTTCGATCAGCTGGAGGGTTACGCTTTGGCAGCAGGA
ATGGCGCTAGGCCTTGTCGTACTGGGGCGTGGTCAATCTACAGCAGGTGACCCAGGACTGGCTGACTTGAAGCTTGAAGAGAAGCTTCACAAGTACATTG
TCGGCGGAGCCCAACAGTATCGGGATACAAACGTGGCTGGAAGCTGCCTCTATCGTGGTCGCCGTTGGCAGGCATTTGGCAGCGGGGGTAATGGTTTCAA
TTACGCAGTAAACGGCAACCCCACGGCTAACGACACGCCTAACAGCAATACCGGAGCTTCTCCTGGCGCTGGCCGTGACGCAAAACACGTGAACGACCGC
GGCGGGGCTCGTGGCGGTGGCGAACACGTTAACGTTGGAGTGACTGCGTGTGCAAGCGCTCTGGCACTAGCATTCATGTACATGCAGACTGACAACAAGG
CCGTGGCTGCGCAACTGGTAGTCCCCGACACGCTTATTCTGCTAGACTACGTTCGCCCTGACATCTTGCTGGCCCGCACCCTAGCAAAGAACCTAGTAAT
GTGGAGCGAGATTTCGCCAACTGTGCAATGGATTGACCAGCACGAAGTCCCAGTGCAGCTACTTCAAGCATACAAATTTATCCAGCCGCAAGCAAATGAT
GCCAAGGGGCAAACGGAGAATCCTAGCGCCTCACCAATGCACTCTGACCTCCACTCAATTTGTGAGGCTTACGCGAATATTGTTGCAGGGGCGTGCATGA
GCATTGGGCTGCGGTTCGCCGGCACAGGCAACGTGACCGCTCGAACTACCCTTCGCAAGTATGTTCTACATTTTCGGGAGTTAAGAGCGAAATCGTCGTC
GTCTTCTTCCTCGATGCGTCTGCGAGGTAGTAACAACGTCGTTGCTGCTGCGACGGAACGTGCAACTATCGAGAGGTGCTTAGCTGTGTGTGCACAGGCG
CTAGCCCTGATCGATGCTGGAACTGGCAACATCGAAACGTTGACACTTTTGCGCTCGATAACATTGAGGCAGCGCGTTGATGCGGGAATGAGCTACGGCA
ACCACATGACACTCAGCATGGCGATCGGGTTGCTTTTCCTCGGTGGTGGCCGTGCCACAGTTTCACGATCGAAAGAAGCTATCGCGGCGCTCGTAATATC
GCTCTACCCGATGCCGCCGATGAATACGGCTGACAACAAGTATCATCTACAGGCCTTCCGCCACCTTTACGTGCTAGCGGTGGATAATTCTCGATTGCTG
GAGACTGTGGATGTGAACACTAAAAGAACCTGTGCTGTCCAAGTTCGAGTTGATCTTCATCCTGTCACACTTGGCTCTAAGAGTGAAACTCAACCTACGT
GCAAAGTGTTACGCAGCCCGTGTCTTCTTCCGGATATTGCAACAATCAAACGCCTCGTCATCTCTGAACCGGATTTCTACCCGATTGAAATCCTCACTTT
GCCGCCGTCTGAAGAGCCAATGTCTTTGAAGAACAGCAACATGAGAACGGCCAACGCTCTTCGGTTGGAACTCTTACAAAACAAAAACTTGGTTTTTCTG
AAGCGGCGACAACGTAAAGACTTCGGGGGTCTTGTGGATCTCCAAGAAGTGCACAATGGACACGTGACAGCCCGGGGTGGAGGTAACGACGACGATAGAA
TGCGGAGACTCTTTCGGTCCTACTTCACGACGGGTAATAGTGGTGACGATGATGACTGTGAAGACGGCGAAGATGAAGCGGGTCAATTAGACGTGGTTGA
TTGGGGAAGTAGTTGGTGGGCATCCCAGTTAAACCCACGAGGACTGGAATACGTCCGAGAAGAGGCACAATTGCTTATGCCGCCATACTTGAACGCCTTG
CATGCGCTCTTTCGGCTGCAGCAAGTGCCGCAGTTAGCATGCGCCACGGAGATCGTGACGTTGAGTCTGTTCAGTGATTACTGCCGCCTGCATGCATCAT
CTTCAGCGTCAATAACCAAGGACCCGGTCAGACTGGAGGGAAAACCTTCATTATCCGATTTTGGCGTTTGGCTCTCGAATCAAACCGAGGAGGCCCTAGG
AGCACTTTGGCATCGAACGTCGCTGTCAATTACTTCGCTGGCTTCTGCGCGAGTCAAGCTACTAATGGAAACCCCATCATCGTCATCACCGACGAAAAGA
GCCCAGTCACTGGCGGATGAATTCTTCGTCAGTGTTCTGGTGCGCTATTTTGCAGGTCCGTCGGTGTCGTCACTACCACTTGCAGAACAACCCCAGCGTG
CAGATAAAGATTGGAAGGCCAAGTTTCAACGAGTACTTGCTGCGTGTTCACAAGCTCAATCTCAATCGCTGAGCATGACTTCGGCGCCAGCACGATTCCA
GTTGTCAGCATTCCTCGAGCAGAATGAGCTTACGGAAGCTGAAAAGACTTTCTGGCTGAAGTTGGTATCGTTCTTCCTATTTTCCAACTAGCAAGTGAGT
GCAGTCGCAGCAGGTAACTACCATGTATGCATGAAAAGACTGGGTTTTGCTAGTGTTATTTAATTTTTATTGTCTTGCAGGCTGAGCAATGGGAGCTGCA
TCAAGATGACAGCCACCTCTATGATCCACCTGCAAGTGTGTTTCCTATCTATTCACCCCGGGTCGACGAGAAAGAGAGTTCAATCTTCGTCAAAACCGGT
GACGGCCACCGCCTGCAGTGTCTTGTCTGGTAGCGCTTCGTCGCTGTCGTTCGCGAGCCTGGAATCATGATCATACGCACATGAGGCTGCTACTCGCTTC
TCAAACAGAAAGTCTGTTCACACTCACCATATCGCCGTTCTGCACGCTTCATCATGGTTGTCGAGGAGTGTCCGCGCAAATCCTCGCTGCTGCTGCTACC
TCTTTTTTTCTGTGGGGAACTATTTTCTCTTTTTTTTTCCATGGCATGGTGTTCCTCTTTTTTTTTTGCCACGTTTCACCCACGCCACTACTGCCCCGGG
CACAACCTCCTCAATTCAGTTTGGCAAAAGTGATTTTCATTTTACGTCTCTTGCGTGGTGACGACACGGCTGGGGGGGCCGCCGCCTGCTCCACGGGCTT
CTTCACCACCTTTGCGGGAGGTGAAGTAATCCCTTGAGCCGACGCACCATTTGTCGACGTATTGGCAGAGTTGTCAGCAGCACCCAACGATTTCCCGTCC
GGGCTGCCGGATTCAACCACAGCCTTGCCATCGCGATCACGCTTACCTGTAATTTCTGGAGACGCCGACGACACCGTCTTCTTCGGCTTCACAGGAGTGC
TGTGAACAGAATCAGTGCCGTTTGTCGCCTCACTCCCGTCAGCCGCAGGATTCGGGCTACCTGGTTGCGAAATACTGCCCTTCCATTGGCCATCTCGGTT
GCAAGTGACGCTGCCTGTTGACTGCTGCTCAAATCCTCCACTCCATCCTCTTGTGAGTGCACACCTTCATCACCCGAAGGCGGAGGGCTTGGTGCCGCGA
CCTCCTCGGCCTTCTTCTCCTCTTCTTTCTTTTTCTTCATAAACTCACGACGGACAACACGTGCAACAGCGCGTCCACCCATCTCTTCGAACACACTCTC
AGGCAAAGACTTCCAAACAACCGCAGTAACTCTCACGTCCATGGTCGCCGTTCGTTTGTTCCAGCGGTAGAGATCGTTGTTCTTGAAATACTCCACCGAG
CTGTCAATGCTCACTTCACGACTGCGCAGCTGGCGACGGTCAATATCAAAGCCCACGTAGAAGCAGACGCCGAACTTGCTGGGCTGCGCTGGGGTTCCGC
CGTTAGACTGCTCATTCGCTGGAGCCTCACCACCTGTCACAAAGTTCAGTGGGTACTTCTTCGTGAAAGCGCGCAAACGGCAAAGCGCCGGATTGTAGGC
GAGCGACTCCACCAGCTTACGCATACGAGACTCGCAAAACCCGCACCACGCCTGCTCCTCGTCCTGCTTCTCCGTGTACACCTCGACTGCGAGGTAGTGT
TGGTGGACGGCGAAAAAGTCCGAGGGCTCAAAAAGTGGCCCCCATTCCGAACCACCTTTGCTCAGCACATCTTGCACAATGGTCAGGCCGCGCTTAAACT
CCTCCTTCATAACCGTAAGACTGTGCGTCGACACGTTAAACGAGGAATTCATCGACGGGTACGCCGGCGTCAGGATCGGCATCACTTGGTATCTAAAAAC
ACATGAGCAATCATCCAAACTCAGTTATTCGTCTAGAAAAAAAAGCTGACAGCAATCTAGCCAACTCACCGGTTGTGGCCTGCGTTGGCGTTCCAAATTT
CCAACCCCAAATTGGCGTCCTGTGTCTTGCACAACTGGATAGCGAGCGGCCACTTCCAGTTGTTCAGCACCATGAAGAAACGCAGCAGCAGTGTCGACGG
AGCCGCGGTCGGGTACAGCTGGTTGATGAAGCACACCAAGATGCACCAATTGACACCTCCGAGGTAGCCCATCTTGTTCGAGTACAGTCCTCGACGTTTG
GCCCAGCGTCTCACAATACGGAGCACGCCGATGAAGCTCTCCCGGTTCGGGGTGAGCTTGATCATGAGCTCCGTGACTCGAGGGCCATTGAGACTCTTCT
CGGTGGCGGGGTCCACGCCCACAAGCACATGGTCGTCCAGAATATTTAAATTTTCAGGGATTGAGTTCCTCGGCAGGATGGCAATTTGTAAATCAATGTT
AATCTCCTCGTAGTCGAACGTCAGGATGGGCACGATGGCACCCTCAATAGCCACGAGGTTCGAGACCTTGGGGTGCTGCAGGAAAATGTCCTTCAAGGAC
GAGAAAAAGTCCTCGCGCGTCACGTGGCGCGGCGCCACGCAGATGGTGTCGATATCCGCGCCCGGTTCGTTCACCCCGAGGCGGTACGAGCCCGACACGA
GGATCTGGCCGCCGGCGTCGGCCGCCATGTCCTCGGGCACGCCCTTGTCCATGCACACGCGCTTCACCCATTGGCGGAAAATCGAGCGCAACTCGGCCAG
AATCAGCGAGCGGCGCGTGATGTTGGCGTCGGATTCCGTGGGGAAGTGCGCGTCCATGAAGCTTTGCAACTTGGCCGACTGCTCCAGGTCCTTGGGCTCG
GGCGGCGTCGTGCGGATGGCCTTGTACGCCTGCTCCAGCACGTGCGGCGCCACGGTGAACGTCGCGCTCTGCATGACGAGAATCGGCGAATGAAGGCAGC
CTGTCCGCAGTCCGTTTCGCGCTAATCTGCTTGTGTCACTCAAGGTGAACAATGCCAGCGCTGTCTCTGTGTCGCTCATTGGCGGATAAAGCTTCTAGAT
TTCATTGGTGGAAAAGAAACATTATTTTATCGACCAATCAAACAACATTTGAAATTGAATTTTGAATTTGCAGCACTTCTCGTGGCCGAGATGGACGACA
TTGAGGCGCTCATGCCCCGCACCAAGTACGTGCGTGTCCCCCTGGTGCTGGGGGATACAAGGCGATAATTGCTGATATATTGTGTGTGCAGAGCGGCTAA
TGACCGAGCGCCAGTGGATGGGGCCAAGCTGCGACAGTACATGGCCACCGCCAACACTGAGCACGTCGGAGCGTACGGAATCTTGCGGTCATTTATCGTT
TTTTATTTTCTTATTTTATGTTCATAACATTGTAGCCGCTCCGGTGTCGTGGTGCGCGGCGATGTACGCAAAGACGCTGAAGGGTTCGAGGACATTGACG
ACTTTTGGGTCGACGAGGACTCGCTGCAGGACGACTCGGTGGACGATGACGATGACTGTGCGCGGCAGTGGCTGCAATTTGCAGGAGGATAAGAGATGCT
GACCCTGTTTTTTAATTTTATTTTGACAGCACTCACGGTGTCCGATAAGGATGAGGCGGATACGTCGGGGGACATATCGGAGCCGAGCGAGCATGAGGTG
GAGCTGCCGGAGATTGACAGCCCCGTGTCCAGTGGCAAAGACAGTATAGACATTGAGCGAGGATCGATTCCAGCGAGATCGCAAAGAAGCAGTGACAGAG
GGATTTTGGATATTGAGCGAGGCTCGATTCCAGTGGCATCGCAGAGAAGCAATGCCCGAGCGGAAGAGGAGAAGAAGGTTGGTGCATCTGAATCGCCGCC
GCCGTCCCCCGCACGGAGCGATATTTCGTTTGATTTTGGTGGCTCGCCGCATGGCTCCGTGGATATGGATGCAAACATCACTGTGCGTGATCGACGCGGC
AAGAAGTCTACTGGAGCTGGTGGGGATAAGGCAAAAACGAAGGCTCGCCGGCGAGAATCTTCGGGCGCCGTTCGCGGCTTTGATGAGGATGCAGCGAGTC
CGTTTTCTATGAACGATGGGCCGGTGACTCCACTGTCAAACGGTGCGTGGTGCTTCCGGGTTAATGCATTTTATTTTCAGCGATGACTCATTATACTGCC
TTGTTTTTTATCTTGCTGCAGCGAGCGACCGTACGTTGAAGTCAATTCCGTCATTTTCGGGAAAAGACTCGGTCTCGCCGACCATCACCAAGGAGTTATT
CAAGGAGGGGGGATACCGCAGCGATGCCAGTGAAAGAAAACCGAAGAAAAAACAGACGAAGAAGCCGAAAAAGGCTGCGGATAAGGGTGGTCGCAAGACA
CCGCGACTGCGCCCGACGGGAAAATATGGCTACCGGAGTACTCCACCCGCAACCGATACCTCGATCCAGTCCGTGCAGACTGACGATGATAATGACGAGT
CTTTCGAGGCGCAACACGACTCTGGTGGCGAGACAGGAGATGACAGCTTTTACAATGAGCCGGACGCGCCGAGTGGCAGGGTTCGAGACAGGTTACCTGA
CGCCTCTAGGATCTTGGATGACGACGAAAATGATGAAGCTTGGGATGGCAGTGGCCTGCGTCGGTCGAAGCGGAAGCGTTACAAACCGCTTGCATGGTTT
AAGAGTGAGCACATGGTGTACGAACGCACCTTTGTCGGAGTGGGAACTGTGCTGCCTACGGTTGTCGGCATCGAACGTCTCGGTGCTGATTCTCCAACAT
CAAAACGGACGAAGTCTAAGCCTCCGTCGAAAAGGACGAACAACAGCAAGCCCTTGAGACTGAAAGATCTGCCCAAGGACGTGCGAAAGCGCATCGTGGA
TAGCGAGTGGGCGACGCTTTACGACGGTCAGGCCGGTTGCATGAACGACCTGAACATCATCTGCCGCTCCAGTGAGATCCGTCTGCGTAAGCTCCCCACG
GAGGAGAGAGGCGGTGCAGTCGTGCACGCGTACGCGGGGCAGAGTTTCAACCTTTTTAGTCCGTCCCCTTTTGCGCGGTGGATCTCTGGACGTGTAGTAT
TGCCTCCCGGCGCGTGGAAGGAACCAGAGGGTGTTGGTCAAGCCGTGCAGTTGTTCTACGTAACTGGATGCCAGCCAAAGTCGCTGGAGTTGGCGGTGGC
GCCCGAGACCGATGACGACTTTTTCACCAGCAAGCACACGACCCACTTTATGCTAAGCCCAGGCGACGAGTTCTACGTGCCGTCTGGTAATGTGTACTAC
GTGAAAAACCACTCGGGCTCTGCGGACTGCGACTTGCGGTTCACGATTTTAAAGCCCGAGGCGCCGCAAATGCCATCCGACAACAATGACTCCGACGCGG
AGAAGGAGGAGACGAAGCCTGATCCGGAGTCAAAACCCGAAGCAGCAGAAGCACTCGACAACGAGCTGAAGCGCAAGCGAGAGGAGGACGTGGACTCGGA
CTCGGTTTAGAGCGGTGTGCATTAGTGCTAGCAGCAGCCGTCTCCTTTATTCAGTACTTCGAAGTAGATTTGTTTCCTCTTGTTGTGGTGGACCGTCTCC
GTCGTGACATTGCTGTCACACAGTAGGACGAGGAGCCGGAAAACTGTCTGACTCAGCCGGATAAAGCACCGGCTCCTGATTACGATCGATACGGGCATGG
CATCTTCGTGGTGGTCTCCAATATGTAGCGGCGTCTCAATTTCAGAGACTCGCATGGCAAGGAAATAAAACTACCATCGCCATTGGGTTTTGCGGCCAAG
TGTCCACACGCTGTGACGGTAGCACGTTACAGCGTTTGAAGTTATGCGCGAAAACGACGTCGTGGGCCACAACTGGTAAAGCGTCGTCAACTCGAGCGGC
GATCTATGCGCGCACATGCGCATGGGCGCGGGTCTGCTATAAAAGCAGATGGAGTCTGCACGCACGAAGCCTCTATGGGTAGGTGAGCGAGCACAGCTGG
AGGGCCTAAGAATACGCGTGGCGCGTGGTTCGGTGTCTTGGTGTCAGACCGAAAGAGAGGGGACGAGGTTGTCAGTGGCAAAGAGACTGAGTGTCGGACA
GCCAGAACACCAGCAGGTGCCGGCAGACTGCTGCCTGTCCTATACTGCCTCGCTAGCTTTCCGTGTTGCCAGCTCCCGATTGCTTATTTATCGTTATTGC
GCGTCGATCAGCTTGATTCGCGCTATGGATCCTGCAGCTTCATCGTCCAAGTGCGTTCTCAGTTTGCTGGGTACTGGTTGCCAACTAGATGTGCTGCTCT
TTACTGACGTATGGGCTGCGTCTGCGATAGGATGGACGACGTCTACGAAACCATTAAAGAAGGAAGCGTGGCTGTCCGAGGGCATTTCATGGTACGAACG
AGTCCAGTGTGGCATGAATTGATAGGAATATCGTGGTCTCACTTGTTGTTGGCCAACTTTGCAGTGGCGTGATCGCTACGTTGGTATCAAACCAGGCGAA
ATGATCATTCGTCGCCGTCGAGACGGCACCATTAAAGCCAAGGTTTGTGTCACAACTTCGTTTATCGAGACCAAGCTCGTTCTCATTTGTTGTTGCTGCT
GTCAGATCGACTTGCTAGACACCAATATCAAACTCACGTTCCTCGGCGGCCAGTCCTTGCTTACCATCGCTATGCACGGACGGGATACTGTTTTGGACTT
TCGCTCTTCAATTACGCGTGACGAGTGGATCAGTGCTATCGTAAGCGCACAGGAGCGCCCTGGCTCGGACGCTGACTGCGACGACGATGGAACTGAACTT
CTTTCTGGCGAAGAAACAGACGAGGGACACAAGCGTAGCTCCATGACGAGCTTGGGGACCGAAAAGACCGACTCCATAGCGGAGGATAGCTACAATGATG
CACTACTTGCATTGCAGAGCGTACGTGATTCCGTAATGCAGTGTCATCTCTCGATGAGCGCAGCCGAGGTCGACTCGTTCATTAATCCTTGCGATAACCC
CATCGCAGCAGCAACCTCAAAAACGATTCCTTCACTACGACGAGCCCAAAGCGCGACGCGCAGTGAAGAGGAACTTCGACAGAAACGCCTTCGAGCACTG
CTGACGATGATCGAAAGCACGCCTCACGGAGGACGTGTTGTGCTCTTGCACCTCGGAGTAATTGCGTCTGCAGGCATCACTGTTGGCGATATGCTGTTGG
CACTTGGAGAAAAGCAGCGGGAAAACCCACGTCGTGGCTCCTTCACTCCGCGTACGCTGAGTGCCCAAAAGCACAGCATTGCGGCGTTTGTGCGCGATAT
TTTGTTCCACCCCATTTACTCGAAGCGCGAGGAGGTCAACACCGAGATTGTTCAGGGGCTCATCGACTTGTTCTTCCCACATTGTCGGTTGAGGCGGTTT
AGTGATGACACGGAGTGGCATCAAGTCCAGCCGTCGGCTTCGGTAAACAACACATCCAGAGTTACAACAAAAAGTGAAAATGATGCTGACGTTGGTACTG
CAGTTCCGACAACCCCGACCGTAGCACCGCCAACTCCTGCATCGCGTCTTCAGAGGCGAAAGCGACGGAATCACTCGTTCCCGAATCTGGGTGGTATATC
TCAACTCACCAAGAGCAAGGGTTTGAAACAGACCTCGGTCGATGACAACGACCGATCTATTAGCACGCGCAAGTTGGAGGAAGGCAGCCAACGGCTACGT
GACAATCTGTCCGTGCTGTTCGCACCATTCCCAGACAGCAAAGGCCCCAGCAGCGGACCAACTCCGTTTGTGAGTATAAGCACACCATTCGCCTCCGACT
CATCTGATGAACTCGATGTAGTATGCGAGGACATACCGCTCCCCCAGCCATTGCGGAAAGTCTTGTGGGAAATGTCGTGCTCAGAGTTAGCTGAGCAGCT
CACGCTTTTTCATCACTCCCAACTCTCGAACGTGTATCCGTGGGAGTTTTTGCACCACCCCAAAGAAGCTGCCATGGAGTTGACCGAGAACTTCAACCGG
TTGGTAGCATATTTCGTCTGGTCTGTACTGGTCGAAGACTCTCCAAAGGAGCGCGCAGAGGTCATTGAGAACATTATCTCCATTGCGATGGCCGCAAGTG
CATCCCCGCTTAATAACTTTCACCTGGTCATGGCTTGCGTGGGCTGCCTCGGAGATACACCGCTGATGTCTTCACGGATGCCGATCACGTGGAAGAAAGT
TCGGGCCAAGTACAAAACTCGTCTAGGTGAACTTCGACGGCTGTGCGACCATACCGGCGGCTTTGAGAACCTGCGACGCAAGCAGAGCACTGAAAGTGCA
CGGCCCATGCTTGCCAGCGACGTATCGACTGTCTCAATTATTCCCTTCATCGGCGTTATCGGGGTCATGCTGGAGCGATTGCGATCAATCAACTACTTCA
CCTCGAAGAAGATGTTGGACTTGGAAAAACTTGAGCGGCAATACACGGTGCTCAATGTACTCGAGAACGCGTTGCTCAAGCCCGCTCCACGGCCTTCTCG
GGTGCCTCAACGCGGTAAGGTAGCCCCCATGGAATCGGCGACGGAAATGACAGCTCGCTTGCAACATTTTTTCCGGACACTCAAAATGGACTTTGCCTCG
CCTCGACTGCATCAGCTACGCTCGCAGCAAATTTTGGCAAGCGAAACGAGCTCCACGAGCTCAGCGTCGGCTTCTTTTGTATTATCAGCAACCGTCAACG
GGAGTAACAGAGGCGGGGCCCCATTGACTGCAACGACCCTGGCAGTGAGCAAATATGACGCGCAAGGTTCTGTAGGTCCAAGTGAAGACTCTGGTTTGGC
ATTCGTGTCCTTCCGAGACATTTGCGTGTTGTTAGTGTCTGTCCCGGAGATGCATGAGCGAATGCAGATGGCTCTCGAGGCGCTCTTCGTAGACGGTCGT
CAGCCAGCAACGCAGTTCCTGCGCAAGTTTTGGCTCGATTTCAAGCAGAACGTCTGGGTGTCCGGCGTCGGCCCCACGCTCCAAAGCGTACGCGTCTGCG
TGGCCGCCCTGTACCAGGAAGTCATGGCGCACAAAATCACCGAGCTCATGCAGATCAGCGGACTAGACGAGAACTCGGCTGAGCTGCACGACGTGGTGTA
CGCAAAGGCCGTGGTGTTGACCGTGCAGCCTATTTATCTGAAAATCGTGTCCAAGGTCAAGCGCAACTTCGTCAAGGAGGACGCGCACGCAGCAGCACGC
CTGCTACAGAGTACGCCAAAGGTTGTCGTCGACACGAGCCTGCCGACCATGCCGTGGAGTAGTTGCAGCTGCACTTCTCCCGTCGAGTTGCTGGACCTCG
TGTGCCAGTTGACGACGCTGCCTCGTGCCAGCACCACCAGTGCAGCCACCGCTGCGACCGACCACCAGCTCGCGGCGGTGGAGCTGCTGGGCGCTCTGCA
GCATCAAGCGCGACACACCTTCCTCGCCACGAACCCGGTGAGCAGCTTGTACCTCATGAAGCAGATCCTGGACCCCAAGTACCTTCCTCTCGCGCGACGA
CAAGCGCTCGAGGTCTTTGTCGCGGCGGTCACGTGGCTGCGCAAGGAGCAGAAGCTCTCCTCGGACGAGGCGCCGTGAATCTTCCAGCGATTGCACGCGC
ATGTACCGGTACAGACAAGGCCTGAACGGATGACAGCCTGGTGACGCCCGACGCCGACCGAATGAGTGCACGCACACGTTGTTTTATGGCAGCGCATGTT
TCCTACAAGAGCCATCCATCCCCACTGAATTTCGGAGAGATGGCCAGAATATATTATCTCGCGCTTGCCATCGTCCTCGTATCGTATCGTCCTCGCCGTC
TTGGCCCATTGCCCCGAGAGTCAGGGCAATGTGCAATAAGCAAGTGAAGGTGTCAACGCACTTCCAGCAAAAAAGTATCTTTTGTAGCACTGCATAGCCG
GGGCGGACGTCCTTTCGCCGGCCAATAGAAGCGCCGATCTTGATGCGCGCCGATTTTACCCACTCATCTCGCTCGATGTCGCGATATTCCCATTGGCTGA
AAACCCGCACAGTGGGCGCACAGTAAGCGTCAAAAGTTACGGCTCCATGTAGCGTGGTGTCGTCGCTCGCGACTTTCCTGGCGGAACGAGCGCGCACTCG
TCCGCCAGCGCCCCATACAATTCCCTCCCTAGACCTTGGGCGCAAATACACCCCCCTCTGATACGCAGCCACTTCAGCACTGAAGACAGAACCCCCTCCC
TCGATTTAATAACCCCTCGGGTATGCGCGTGTGGACTCTGGCGCTCGGTCTGCTGCACGCCGCGTCGGCCGCCAGCTCCTCCGGCTCCGGCGCGAGCGGC
ACGCGCAACACGCTCACCACGAGCTGCAACGGCGGATGCAGCAACGCGTGCGTCGTGGTGGGGCAGTCGTCGGCCAACGCCATCGACTGCGTGAACGACA
CGAGCTGCGTGACGCTGTCCTCGGGCCAGTCGGCGCTGTGTCTCGACGCCTTCGCCTCATCGGCCACCGAGTGGACGTTTCAACCGGCCGAGAGCAACGA
CACAGCAGGGGCCGGTCCCTTTGAACGCGTGGGGCTGCTGCAGCTGGACGGCCAGGTGACAGACCTCACGTTCACCAAAGCAGAGCAGAATGAGGAACCG
CTCTCGGGAACGCTCGAGCTTTCGTCCATGAACATCCAATCGGATGCGACGCTGGACAAAGTGGCGTTCAGGAACTTGAGCTTGTCCGGTTTGGACAGCG
CCTTACCGCTCAACAGCGTCAGAAGAATGTGCGTCGCTGTGATGTTGCACGAGGAAGAAACTACCACGACTGACACTGGTATTTTATGTGGACAGATATT
TCAACAACTGCTCCTTGAACGCCATCCCTACGGCTGCTGTGGCTGGAGACTCCGTCACTGTCATGTAAGAGCACATTCGATGCACTGCTTGCAGAACTTG
TTCTAATTTTCATTGTTTGTGGTGCAGTGATTTAGCAGGAAATGCCATCGCGGGGGTGGAGAGCGATTTCCAAGACGAGTCTTTCCCGAATCTTACTGTA
CTGTACGTGCCAACTTCTGCTTTAACCTAGACTGCACCAACATTGCTAACTGAAACATGGTGTCTTTCGTGCAGTGATTTATCGGCGAACACTCTGACGG
ACTTCGACCTCGTGGTAGACAACTTTCCAGCGATCACGACCTTGTAAGTTCGCCTGCGGCGAAGTGTGCGCTGCTCGTAGCAAGCTTCCGACTCACCTTC
CTGTATTCGTGTGCTTAGATTTCTCCACGACAACTCGCTGGCATCTGTTCCCGACGTGGTCTTCAATTTGTCCACACTCCAGCATCTGACGCTGGCCGAC
AACCCTATCAACGCGTCGGGTCTTACAGTGGACCAGTTCGCATTCCTCGCGAATCTGAACATGTTCACTATGATGGCACCACAAACACGAGCGCATGCCC
AACCTCCGCTGTCCAGACCGCGCTTAACGAGTCTTTCACGTTTTGTGCGGGGAATGGAGACGACATAGAACCCTCAAACGCGACAGTCACGGAGATGCCA
TCGACTACGGTGCCTTCAACAACTGAAGGTGCTTCATCTTCCTCTTCGTCGCACAAAACATGGATTATTATTGGGGCGTGCCTGGGTGGCGTGGTGCTGC
TGTTGCTGATCTTCTTCATATGGTGGTGCTGCCGTCGGCGGAGGAACGAGCAACCCAAGCTCATGAACAGTACAACTCCATCAATTGCAATCGGCATGGG
CGACTTGTCTGACCACCCCTACATGGAATGGGTGTTCCTCGATCCACCAACGCCTCTAGCCAGACGACGTCGGACTTTGAATTATTGGCGTCTGTGGCAG
ACGGCTATATCGGACTTACTCGGCTATCGTATGACGACGTATTCCTGCACAAGATGCTGCGTGTGAGCAGCCGTTCGGAGCTATGGCTGGGCGAGTACAA
GCATGAGGTTGTGCTTGTCAAGAAAATCAAGAGCAACACGGCATCAAAGGCGTTGATGCGGGACTTCGTGACAGAGATCGAGCTGATGTTCGAGCTGAAA
CACCCTCGCATTGCAGCCTTCCGGGGTGCTATGTGGGATGCGGACGGCACGGAGCTCTGCGCTGTGGTCGAGTATGTTGAAAAGGGAGCGCTGCGTGATT
GCACGGTTAACAATGCCATGGAGCTGTCGGTGCCAAAGCAGCATACCATTGCTCGCCAGATTTCAGAGGCCATGGCTTTCCTTCACAAGCAGAACATTGT
GCACGGCCGGCTGAATGCGTTCAACATCCTTTTGGACAAGGAATATTCCGCCAAGCTTAGTCTGTTCAGCATTTTCCACTACGTGAAGCTTTCGCCTTTA
GACAACGAGTGCAAGATCTTTGCCGCCCCAGAAGTTCTGCGCGGTGAACAACCAACTGAGAGATCTGATGTATACGCATTCGGCGTAGTGCTCGTGGAAA
TCGACACAGGTGAGACCCCAGTGATGAATGCTCGGAGGCTATCGATGGAGCGATCGGGTCGCGAGGATGCTCTCTCTCCAACCGCCAAGAAGACTGGATT
CCGCTTGAGCCGCCTCTGCTCCGGCGTGATGAAGGAGATTATTGCAGCCTGTCTGGAAAAGGACCCTGCACGACGTCCATCAATGGCTGACGTGGCATTG
GCTCTTAAGACTGGAGCGATGAAGCTGTGAGGACTCGCTCAGCAACGAAGGCAGGCTCGACACAAGCCACTCTGGATTTTATTTTCTACTACATGTACCG
GTACTAGCCTGGACACACGCCAATAGCGTAAAACGCTGCTGCATGAAGCAGAACTCGCGGTAGATGTAAGCCCGAACTCATGTAAATGGGAGGCAGCCTC
CCTTATTTTTACCCGTCAGGAAGCACAAGAAGAGCACTAGCCAGTTGTCGCTCTTTGTATAAAAACCACATAAAAACATTTAGGAAGCTGGTGGTTTTTG
CTGTCACGGGGACAAAGCGAACAAGGTGAGTGTACGACAGCATCAAATTGGGAGCAACCAATGTTATGACTCATCTGATTGTCCAAACATATTGAAAGAA
TTCTCATGCCTGTCAAGTTGACAATCAAGTCAACCAGTCGATTCAGCCCTGGAGTCAAAGCCAGCGATGAATGGCATCCTTCGCTGGCGCCGCATCTGTT
CCCGTGTTTCCAAGACACCGAAAGCTTTCTCCCCGTCGTTTCGGGGGGTCGTGCTATTCATGTATGTACACGTCATTTCGATTTCCTCGCTAATCACATG
CAAACACGTTAGCAGACATTGCCGTGCCTCAAGCGATAATGCAACCAGTAGCACATTGCATGAAAAAATTGGATTGCCTTTTTCTACAAGCTCGAAGTGC
GCCAAAGCTATCATTGTGCCAATAAATATTCAACGCGCCTCCCTACTCCTACTCCTCCAATTCGCCCACACAAAACGCAATCCAATGTGCGTGGAGCTGG
TAGAAGTCTCCTATGATTTCCTATGTGCGCGCTCGGGTATGAGCGGCAATCACCATCATCGTTTCACAGATTTGGGCAAAGCGCCAGTGCTGGTGGCTTG
ATGCAAAGAGCACACATTACCATTGCGCTCGTAAGCAGGCTTGCGGCAGCCTTCCACAACACATCGCTTGCCTGTAAGAAAACAAGTGAGAAAGAGCAAA
AATAAGCAGCAGCACGCAAAAGCAACACAGCGAAAAGAGAGCTCTGTGCGTGAGTATAACACGATCAAGAACAAATTGCTTGAGTCAAAGTAGTCATGCA
GCTCACCTCCTCCGTGAGCCCAGCAAAGACCGTGGGAGACTGCCGTCTTGGTACAGTTTTGTTCGCTGCATTTGCGACCTGAAAAGGAAGCGGAATTCAA
GTGAGTTTTGCATGACCTGTACGAATGAAAGGTAATCAATCAGCACTGCACCTCCGCCGTGAGACCAGCAGACGCCGCGAGACTTGGCACGGTTCTCGCA
CCCCGCCACGGTGCATTTCGTCGAGCCGCCTGCAATTGTTGCGCAAGGTTTGGTAAGCAAATCATGAAGCCACCTTTTTCAATAATCGTGCTTGCCTTAC
CGTGCTTCCAACACACACCCAAATTTTTAGCACTGCTCGTGCACCCCACGACTGCACATCGCTTACCGCCCTGTTATCAAATCAAGCATTCGGTCAACAT
TGGATCCAATGCGAACAGCGAAACACCGCACAACTGCCACCCACCCCGTGACCGATGCAGAGTCCGCGGTTCACCACGTAGCGCGTGCAGTTTTCAAACT
TGCAGATCCGCGACTTCTTGATCGCAGATTTGGCTGCTGCGGGCGCCGGCACATTGGCCTCTCGGTTCTCCGTCGCCGATTCGTCCCGAGGGGCCCCTGA
ACTAACCGCGAGGTCCGCTGCAACGCACCAATGCAGCAAACACCGACAAGTCACGCTCTGCAAATCCAGTCGGTCGTCCGCAAGGTTGCAAGGATCAGCG
CAACGTACCGAAGCTCGACGTTTGGTCCTCGTCCGAGCCGCCGAGGATGAAGGCGAGCGAGCTCTTGCTGGCCGCGGCCGTCGCGTCCGTGTTCATGATG
GCCTCGAGGCGGTGGCGGTTGGCGGCGACCTGGAGCTGCTGCAGCGCCGGCAGCGAGGGCCCTTCTCGCACGCCGTGCCCATCCTGGCGGGGCTCGTTGG
TCGCCACTTGGTGGAGCCACGCTGCGCTCATGTCGACGTCGTCGCCGGCCGAGTTCTTCATGCAGGAGGCCGGATACAGCAGCATCCAGAGGGGGCAAAG
TCTTGAGATAGGGACCAAAGGGGTGTGGTGGTATTTTATTCTAGTGCTGCCTGCTGCTGGCAGAGTCAACTGTTCCAGCAGTCAGCCGGTTGTTATCTGA
ATAATGGACTGCAAGAAGCAGTCGATTCAAGTCGACGCCTGCCCCGGCTGGCGAGAGAAAAGCCCCGAGCGCGGGCCGATGGTGCGTTGATTGCTGTGGC
CGCGTCACTGGAGACTCGAACCACTGGTGTCCGACAGGCTCCGCTATTGATGCCGGCTCCGGCTTGCGAGCACTTGCCCTTTGTATGTCGCGCGGCGAGG
CCAACGGATGGTGGCCAAAATTGGCCCCATTTCGACCAATCCAAAGTGGGTACACAGCGCCGCTTCGAGCTTCGAAATCCCGCCCCATACTGGGGCCAAG
CTGTTTTCTCCCAAGATCGCGCGGCTCGTCTCT