Description :
From Genome Similarity Track
Location :
contig_60:133314- 157847
Transcript NameFunction/comments
g10691.t1XP_009515941.1 hypothetical protein PHYSODRAFT_309454 [Phytophthora sojae
g10692.t1hypothetical protein
g10693.t1XP_009515939.1 hypothetical protein PHYSODRAFT_474162 [Phytophthora sojae
g10694.t1XP_009515938.1 hypothetical protein PHYSODRAFT_470887 [Phytophthora sojae
g10695.t1hypothetical protein
g10696.t1XP_009515936.1 hypothetical protein PHYSODRAFT_552372 [Phytophthora sojae
g10697.t1hypothetical protein

Sequence
24533 bases(100 bases per row)
TAGGCCAGCTAAATGGGAACGCAGTGAACGTCAGCAACAAGATGATACACTTTTGGGGCGTACGACTTGACCTTCTCCACGTGCTCGCACGTGATGGTCC
ATTGCTTATCGTACTGCTGAGCAAGTTCGCGCATCGTATCTACCACACGTTGTTCCCACGCTTCGCGATCCTCCACAGCCACGTTGTCGTGAACGTGGAA
CCAGCCACCGCTGGGTTTCAGCACTTGCACAGCCAATGGCCAAGCCTTCTCACTCGTAGGCAATAGTCCCAGGTTCACACGGTCTGCCACGGCTCCGATC
GTAGGGGCCGACTCGCGGTTGTCACCGAGGTACACCTTGCACCTATCTGCAACATGGTTGCGCTCCAAGTTGAAGCGCAGAGCTGCCACTGAGTTCGGAT
TCCACTCGCAAGCGTGGACAAACGCAGCGCCTCCGTGCACAAGAAAAGGTAGAACGTAGTAACCAATGCCACAGAAGAGGTCCACGATCGTTTCCCCACG
GCACCCGATGGTTGCCATGCGAGCCTTTTCGGTGACGTTGCCAGATGAAAACATAACTCGCGTAAGATCCCAGCCATAGACGATTCCGTTCTCACGAATC
TCCACCCAGCCCGGGGCCTCTTTGCTGCGTTGAGAGGTAAGAGCCTTTTGATTTATGTACAGCAGCTCCACGTGACTTTGACGCTTTTCACTCGCATCAA
TGAAGGCCTTGCGTGCAACACGAGAGAATGCAGGCGAGGTGGACGCACAAACGTGTGCCCACATTTCGTATGCGAATGGTGCCCACTCTGGCTCCAAGAA
GGAATCACGAGGGATCAGCAAGACGTCGCTCACGAACTCGTACTTCTCTGGAATGGCCTTCACAACCTTGGCAGGGAGTCGATACTTGCTGGCAAATGCG
CCGATCATACTGCGGATCGCCTCGTTGCGGTTCAGCCCACTGGTCTTTCCAAACTTGTTTGCGTACGCATCGTCATCTTTCACTACCTCAAGCCTTTGCA
GTCCAGTCTCATCCGTCGAGGCAAGCAGCTCACGAATAGCTGGCGTGACAGGAAGAAGGAACACAGTCGTTGGCTTGCCTTCGCCCATAACCTGGCTCGA
TTGTGCAGGCGTTGCAACATGAACACGCCGGGACTTGTCGTACACCTGTGCCCTCTCCAACAAAGTCTTCACCTTCTTCACTTCTAATTTTCCAACGAGA
ACGCCTAGCGGCTTGTCATCCGAAGTGGGCAGCACGCTTGTAGAAGGATATTCGCTGAGCTGGCCTTGACATGTGACAGCGGTAATTTTAGGGGCCGCCA
ACGACAAGTGACACTGAAACACCGAAGAGTAGAATTGGCCGAAGCCAAAGCATTGGAAGCCACCGCCTAAAATGTAAAGCGATTTGTTGCTCGGAATCCA
AGTAGTGCTGTGTCCCACAAAAGCAGCATTTTCATGCTTCAGTTCTCCCAGCTCCGTCCACTGCGAAGCCTCGACATCCAGTTTATACACTTTTCGAGTC
GCCTTGTCACCATTTGCAAGCAGAGCTGCAGTCATGCCGCCTACCACAATGACTGAGTGATCGCTAATTGAGGTAGCGCTAGCTGCAAAAAGCGCTGGCG
GCTGGCTTTTGTTACTGCCGTTCTCGAGAACCTTGCGTTCCCAAGTCTCCCCGACAGTATCGAAAAGCATGCACACAGCGCTATCGTCACCACTCTCGCC
GCTGCCATCCACGCCATCCAACGATGACATGCCTCCCCAGAAGACAAGCTTCGTCGAGCTGACAGCCACACCAACGTGATCAAAGCGGTGCGGGATGCTG
GATGTACTCTCTGCAGACAGAGAATAATAAATATTTAGTACACTCCGAAAAAATGGAGTAGGCTTGGAGTTTGACTTACCGATTCGACGCCATTGCGGCG
AGTTCTGACTGAGATCTAAAGAAAATAGATCTCCGAAAACTCGTTCAGCATCGCGGCCACCGTACACGTACACAACAGAGCCAACTGCAGTCACACCAAC
ACCAAGCATGGACAGAGGTTAGAGCACTTTGTGATTCCAATTCGTCAAGTAAGAGCTTACCAGCACAGCTGCTGTGCTTCCAACGTGGAGAGGGGCAGAC
TCCTCGCGGATGAATCTGCTCCCACAGCTTGGTCTCAATATCCAACGCATACAGGTCGCCCAGGGGTTTCGCGGGGCTAGCACGACCACCAAATATGATC
ATGCGCGTTCCTACAACAACAGCGGAATGGTGCATCCGAGCTGATGGACCAGTAGCTCCAGCGGCAGCGTGGTACGTTTGCTTAAGAGAACCGTCACTTG
ATGGTGCCAGAATTGTCACGTCCGCAATGCGCGTCGTCGTTCCTGACGCAGTCGGTCCCTGTCCACCGAACACAATAATGTTGTCCTGATACTGCACACT
CGTATGCCCCACAAGCTTGACGCCGTCCTCGTTCGTCACCTCCGTCCAGGACCTCAGTTCAACTGAAGAACCACTCCCAACTTGCTTGCTCACTGTCGGC
TGGCAAAACTTCGCGAGGAAGGCGTCAAACAGTCGGTCCGTCTTCTGCTTATTCGCCTCAAACTTCTGGTTCGCGACATCCACGATCCATTGGAGGTACT
CCTCGTCCACCAGCAACTGCTGCGCACTGCGTCCAAGCGGAATCTCTAATCCGTTCGCGGTTGTGCGAATCGCGCACATAATTTTCCGGTTACCAAGCAC
GACCCCCGATTCGCGGAATCCGCTGGCGATGCCCCACTGCAGCAACTCCTTGGCCGCATCCAGGTCGCGACACACCACGTGCATGATGAACGGCTCGTGC
TTGAAAATAACCTGCAAAAGGCACAACAACCATCAGCTCAACACCATAAAAACAACCTAAAAGAGTAAAAATCGTCAAGTGTCAACCATGTTGCTGGTGC
TGGAATTGGCGTCGGGTGACTGCAGCGCCGCCTTCAGTTGGTCGAATGTGATGGTACTATGTTCGGCGATCAACCACTTGCCGCCTTTGGTGATCAGGTC
CGTCGTCGCTTCATTCCCATTGCCCGTGGCCGCTTCACCGCAGAAAACTGCAATTCGCCCCGAACACGAGCTGCTCGTCACCTGTAGCAACATGAAGAAC
CCTATAAATGAGCCCAATTTCCAATTGCAATTGCACCAAGAATGATCACTCACGTAATTCGGGTGGTCGTTGATACTCTTGATCATGTCCACAATGGGCT
CGTCAATGCAGCCCTTGGGGCTCTTGTCCTCCATCGCCTGCAGCTTGCGCAGACTCTCGCGCTTGAGCTGCGCGAACATCGTCCAGCCAGCCACAAAATG
ACCGTCACAAAACCGTCATCGAATTTATTTTCCTAAGTACGTATCAGAATTTTCATTTTGAGTATCTACTCAAAAACTTTCCCTGCATCATGGCCGAGCC
GCGTCTCCGCGTGCGTTGCGCCGGCGTGCGCATGAACCAGCGCGGCATGTCCGACAGCGGGCACGTGTTCTTCAGCGAGACGCAGTACGCGCGGTCCCCG
TTTCTCGTGCGCGTGAGCTTCGACAGCGTCGCCTTCGTGCACCGCGGGACGCACGTCGTGGAGCGTCGCTTCGACTTCCCGACGCGCGTTTTGCACGCAG
TGCTGGCGGACTTCTCGCCGCAGGTCCTTAACAATACAATTCACCAATATGCAGGTGCGTCGCTGCCCCCAAAAGCGCGGAATTCGCCGCTCCATCCCCG
GACGCACCCGCACCTGTGCGTTTTGGTGCGCTCCGACTGCTTAAACATCTACACTGCAGCCGGACAAGTGTTCGAGGTGGCGCTGCCCTTCCAGGCCAAT
AGACTTTTCCCTATGGAAGGCCGTGGACTGCTGCTACAGCGCAGTCCGGCGGCACAGATCCCGCCCACGGCTTCGAAGCGTCCGCGAGACGCGGCGGCGG
CGGCTCTGGCCAAAAAGAACCGGCGAGCGAGCACCAGTAACAGAGGAGATGGAGACAGGTACAAGTACAGTGCTGAAGACGATGGTACGCCTGCGAGACC
AAGGTATTTTACGCTCAGACACCCGCTGGATGAGGTCAAGCCAGTGGCGAGCAAGAGTGAGGAGGAGTTTCTGGCGAGCTCCGCGTTAGAAGCCGTTGCA
GTGTTGGTGGAAGGAGCGTCTCTTGTTTTAGTGGCTTTTCATCGCTGGGAGCAGAGGTTTTGCATGTTTCGACTGAGTGAGGTGGAGAGGAGTGGAAGGG
ATCAATTGATGCCGGAGGTGCGGGTGGTTGATGGACCCACGTGGACGAGATACCGTGCTAGGATGGATTTGGAGGAAATACGGGTGCCGATTGAACCCGA
GTGGCTCGCGACGCCCGTGTGGAAATCTCCTCGAGTGGGACCCGCGACGTCAAAGCCGAGGTTTCTGTCCTCGATTATTTCTCCGCCAGCGGCTTCACCT
GCACCGCCGTCGCCATTGACGGCTACTCCGTCGGTTTCGTCAAGGAGTGATTCGAAAGTGGCTTTCATTGCGTCCGGTGTTGATGGCTGCCCTTTGCTCT
GTATGATGGACAAAGGGGTTGGAACGCTTCTTTTGAAGCCAATCTCGCAGCAAGAAACTGGTACTGCGATGCTGGCTGAAGGTGACGGTGAAGCTGGTGG
AGTTCGTATATTACACTGCCGTGACGCTGTTCCGATCTGTCAGCATACAAGGCGATTTGAAGGTGGAGAATGTTCCACAGACAATATTCCAGGTTCCACC
GATATTGTAGTTCTAGAAAAGGATGGCACGCTGATGTTATATCGAGCACACCGTCCTGTTTGTCGCCTCGATCTTCCTGCTGTGGAACAGGATTGCTTCG
TTGGCAGTGCTGCAAAAGATGGGGCTTCGGAAATAGTACGGCTGATGGGCAATGTTCAGCTAAGCTCAATTGACCGAGGACATGCGTACGAGCTCGTGTA
TCCGAATTTACGCAGCAGCAAGAGCGGAAAGATTTGGCGGTGCGAGCACCCGCTGAAGGTTGTGAGCTCTCCTCTTTTGCAGCAGGTTTTCGATGTGCTG
GATTGTATAATCCCACCTACAGAAATGTGCGAGTTTAAAGCACACGTGATTTATCGGGCTCAACAAAAGACTCAAACAAATCGGAAAGATGATCAGCTTG
CAAATGGTGGGGTCGAATGGCAATCTTTTAAGGAGTGCGTCATTAATATGCTGGAGGAAAATGCTGAGGGTAAGCCAGCAGCAGGAGGGACTGGAAACGA
CGAGGAAACGGCAATCTCGTGTTTTGATGCGCTTTGCCAGAGTGAGTTTCATGGCATGTATCAGTACGAGCATGCAATGCTTTTTGCCACGATGGAGCTG
CCCATCGTGGAGTCAACGACAAACAGATCTCCCGAAAAAATGCATACTGACGACATGCGCCAGTGTCAAGCAATGAAGAAATACTGGGAGACAATGTTTG
CGGGGCTTCATTTACTCTGTGAAGACCTGAAGTTGTCGATTACACTTGTTCAGCAACGTCTGCAACTAGTGGACATGCTGATGGAATGTCGTCACTACTG
CGTTTGGATTCCTTTGCTGCTTATTACAAGAAAGATAACTCTGTGCTGAGACGGCAAGCGAATATGACGATGGAATTTCGATTGCAGGCACCTACGCTTG
GAGAGGGGCTACTTCGCTTTACTTCCTACGGTTGTGTGCCGGACTTGGTTCTGTGGCTACAGAGCAAGATGACTGCGAAATCGCAGAGACTGGCAGCGTT
TCCCATGTTATTGGAGGATGATGATCCGCGGCAGTTTTCTAGAATTTCTCCAGGACGTTTTGTAGGCCCCTTTCGGAGGACAAGAGCAGTTTGTCACGCA
TACGAGCTGATGTTTCCAAGCTCAGAAGAAAACGCGCAGACAAAGGCTTTCAACCTGATCGTTTACCTCAGTCAAGACCCCATCGGTAACGCTCTGTCTC
TGGATGATCTTCCGGTAGGTTTAAGTTTTCCGATCGTGCAAACCATTCGCCACGTGAAGCACCACCCACCCCCTTCCATCACTGAAGACGTGAGCGCATT
TGTGGGGCGAGAGGATCTCAGTATTGCAAGTGCGGAAAGCCTGGCAGATCATGTTGACTATTCGACACAAAACCAGAAACAGCATGATCCAAAGAGTAAA
AGTCTTGATCTCACTGAGGACGACAGTCACGACGACTGCGACGGTCTTGAAGACATTATAAGTCGGAGTCAGCCCCTCTTCCCTACCGACCAGAGAATGA
AGGAGGTTGCACGTTTGCTTCGTTCAAGTCGCCCTCTCTGCCTGAAATTAGAGAAGACGCCGGATTTGTCAGACCTGGACTACGCGCAGCAGCAGCAAGC
CCGTTTGTTGCTTCTCTGTAAACGGTCTATGGCGCTGTCTGTGGCGCGTGGCATGGTCACACTAGGCAGTTTTGATGTTTCTGCCGCGCAAACGCAGATA
TGGCGACTTTCTATACCTGCATTGCCTCTAGTGGGTCGTAAACCGCCGGCAAATGCGATTGTGGAGCTCGATCTTTCCGGCTACGCCAAAGAATTGACGT
ATTGGCCTCAATTTCACAACGGCTGTGCTACGGGTCTACGGCTTCCAGCGCATGATCTCTCGGGCGTCGTCAATCGTCATTGGATTAAATACCATCGACC
TTCAGTGAACGATGCTCCACAGCGAAACCCAACGGGAAGTCAGCAGGCAGCAGCGGTCCAGTCGGTTGACTCTGCCGGCCGTAACCTGGAAGAGGCATAC
GCAGCTCATGCAGGGTTATTGCTGGGAATTGGTCTACGCGGTCACCTCAAATGCTTGTCCATGGCAGATGTGTACAACTACCTATCGCTGTCGAATGAAT
TTGTGACTGTGGCGATCATGCTCGGTATGGCTAGTACCGCTGCTCACTGTCGACGCAAGCGAAAGCAGAAGACCGCAGCAGTGAAGCCTACCATGACGGA
CGATGAGCAAGCAAGTGGAGACACGGAGGAACCATCGCTTGGCGCCGATCATCTTTTTTCAGGTTTCCCAGAGCTCTCATCATCCGATAAAACTCCGCTA
CTCGGAACGGGATTAGAACTGGCACTGGAGCGATCAGTATCCAAGATGTTGTGTCTCCACGTTCCATCGTTGCTACCACCACCATTCGGAGGGTTTTCAG
TACCTGCATCCACTCAGACGGCTGCATTGTTGGGACTCGGCATCTTATATCAAGGCACGGGTTATCGCCTGATGACAGAGTTATTGCTTACGGAGATAGC
GCGTTCTCCATCAAGCGCCCAATTCGCAGGGAACAATGGAAGCGCGGGTCTGTCAACAGGTTCGTTCGATCAGCTGGAGGGTTACGCTTTGGCAGCAGGA
ATGGCGCTAGGCCTTGTCGTACTGGGGCGTGGTCAATCTACAGCAGGTGACCCAGGACTGGCTGACTTGAAGCTTGAGGAGAAGCTTCACAAGTACATTG
TCGGCGGAGCCCAACAGTATCGGGATACAAACGTGGCTGGAAGCTGCCTCTATCGTGGTCGCCGTTGGCAGGCATTTGGCAGCGGGGGTAATGGTTTCAA
TTACGCAGTAAACGGCAACCCCACGGCTAACGACACGCCTAACAGCAATACCGGAGCTTCTCCTGGCGCTGGCCGTGACGCAAAACACGTGAACGACCGC
GGCGGGGCTCGTGGCGGTGGCGAACACGTTAACGTTGGAGTGACTGCGTGTGCAAGCGCTCTGGCACTAGCATTCATGTACATGCAGACTGACAACAAGG
CCGTGGCTGCGCAACTGGTAGTCCCCGACACGCTTATTCTGCTAGACTACGTTCGCCCTGACATCTTGCTGGCCCGCACCCTAGCAAAGAACCTAGTAAT
GTGGAGCGAGATTTCGCCAACTGTGCAATGGATTGACCAGCACGAAGTCCCAGTGCAGCTACTTCAAGCATACACATTTATCCAGCCGCAAGCAAATGAT
GCCAAGGGGCAAACGGAGAATCCTAGCGCCTCACCAATGCACTCTGACCTCCACTCAATTTGTGAGGCTTACGCGAATATTGTTGCAGGGGCGTGCATGA
GCATTGGGCTGCGGTTCGCCGGCACAGGCAACGTGACCGCTCGAACTACCCTTCGCAAGTATGTTCTACATTTTCGGGAGTTAAGAGCGAAATCGTCGTC
GTCTTCTTCCTCGATGCGTCTGCGAGGTAGTAACAACGTCGTTGCTGCTGCGACGGAACGTGCAACTATCGAGAGGTGCTTAGCTGTGTGTGCACAGGCG
CTAGCTCTGATCGATGCTGGAACTGGCAACATCGAAACGTTGACACTTTTGCGCTCGATAACATTGAGGCAGCGCGTTGATGCGGGAATGAGCTACGGCA
ACCACATGACACTCAGCATGGCGATCGGGTTGCTTTTCCTCGGTGGTGGCCGTGCCACAGTTTCACGATCGAAAGAAGCTATCGCGGCGCTCGTAATATC
GCTCTACCCGATGCCGCCGATGAATACGGCTGACAACAAGTATCATCTACAGGCCTTCCGCCACCTTTACGTGCTAGCGGTGGATAATTCTCGATTGCTG
GAGACTGTGGATGTGAACACTAAAAGAACCTGTGCTGTCCAAGTTCGAGTTGATCTTCATCCTGTCACACTTGGCTCTAAGAGTGAAACTCAACCTACGT
GCAAAGTGTTACGCAGCCCGTGTCTTCTTCCGGATATTGCAACAATCAAACGCCTCGTCATCTCTGAACCGGATTTCTACCCGATTGAAATTCTCACTTT
GCCGCCGTCTGAAGAGCCAATGTCTTTGAAGAACAGCAACATGAGAACGGCCAACGCTCTTCGGTTGGAACTCTTACAAAACAAAAACTTGGTTTTTCTG
AAGCGGCGACAACGTAAAGACTTCGGGGGTCTTGTGGATCTCCAAGAAGTGCACAATGGACACGTGACAGCCCGGGGTGGAGGTAACGACGACGATAGAA
TGCGGAGACTCTTTCGGTCCTACTTCACGACGGGCAATAGTGGTGACGATGATGACTGTGAAGACGGCGAAGATGAAGCGGGTCAATTAGACGTGGTTGA
TTGGGGAAGTAGTTGGTGGGCATCCCAGTTAAACCCACGAGGACTGGAATACGTCCGAGAAGAGGCACAATTGCTTATGCCGCCATACTTGAACGCCTTG
CATGCGCTCTTTCGGCTGCAGCTAGTGCCGCAGTTAGCATGCGCCACGGAGATCGTGACGTTGAGTCTGTTCAGTGATTACTGCCGCCTGCATGCATCAT
CTTCAGCGTCAATAACCAAGGACCCGGTCAGACTGGAGGGAAAACCTTCATTATCCGATTTTGGCGTTTGGCTCTCGAATCAAACCGAGGAGGCCCTAGG
AGCACTTTGGCATCGAACGTCGCTGTCAATTACTTCGCTGGCTTCTGCGCGAGTCAAGCTACTAATGGAAACCCCATCATCGGCATCACCGACGAAAAGA
GCCCAGTCACTGGCGGATGAATTCTTCGTCAGTGTTCTGGTGCGCTATTTTGCAGGTCCGTCGGTGTCGTCACTGCCACTTGCAGAACAACCCCAGCGTG
CAGATAAAGATTGGAAGGCCAAGTTTCAACGAGTACTTGCTGCGTGTTCACAAGCTCAATCTCAATCGCTGAGCATGACTTCGGCGCCAGCACGATTCCA
GTTGTCAGCATTCCTCGAGCAGAATGAGCTTACGGAAGCTGAAAAGACTTTCTGGCTGAAGTTGGTATCGTTCTTCCTATTTTCCAACTAGCAAGTGAGT
GCAGTCGCAGCAGGTAACTACCATGTATGCATGAAAAGACTGGGTTTTGCTAGTGTTATTTAATTTTTATTGTCTTGCAGGCTGAGCAATGGGAGCTGCA
TCAAGATGACAGCCACCTCTATGATCCACCTGCAAGTGTGTTTCCTATCTATTCACCCCGGGTCGACGAGAAAGAGAGTTCAATCTTCGTCAAAACCGGT
GACGGCCACCGCCTGCAGTGTCTTGTCTGGTAGCGCTTCGTCGCTGTCGTTCGCGAGCCTGGAATCATGATCATACGCACATGAGGCTGCTACTCGCTTC
TCAAACAGAAAGTCTGTTCACACTCACCATATCGCCGTTCTGCACGCTTCATCATGGTTGTCGAGGAGTGTCCGCGCAAATCCTCGCTGCTGCTGCTACC
TCTTTTTTTCTGTGGGGAACTATTTTCTCTTTTTTTTTCCATGGCATGGTGTTCCTCTTTTTTTTTTGCCACGTTTCACCCACGCCACTACTGCCCCGGG
CACAACCTCCTCAATTCAGTTTGGCAAAAGTGATTTTCATTTTACGTCTTTTGCGTGGTGACGACACGGCTGGGGGGGCCGCCGCCTGCTCCACGGGCTT
CTTCACCACCTTTGCGGGAGGTGAAGTAATCCCTTGAGCCGACGCACCATTTGTCGACGTATTGGCAGAGTTGTCAGCAGCACCCAACGATTTCCCGTCC
GGGCTGCCGGATTCAACCACAGCCTTGCCATCGCGATCACGCTTACCTGTAATTTCTGGAGACGCCGACGACACCGTCTTCTTCGGCTTCACAGGAGTGC
TGTGAACAGAATCAGTGCCGTTTGTCGCCTCACTCCCGTCAGCCGCAGGATTCGGGCTACCTGGTTGCGAAATACTGCCCTTCCATTGGCCATCTCGGTT
GCAAGTGACGCTGCCTGTTGACTGCTGCTCAAATCCTCCACTCCATCCTCTTGTGAGTGCACACCTTCATCACCCGAAGGCGGAGGGCTTGGTGCCGCGA
CCTCCTCGGCCTTCTTCTCCTCTTCTTTCTTTTTCTTCATAAACTCACGACGGACAACACGTGCAACAGCGCGTCCACCCATCTCTTCGAACACACTCTC
AGGCAAAGACTTCCAAACAACCGCAGTAACTCTCACGTCCATGGTCGCCGTTCGTTTGTTCCAGCGGTAGAGATCGTTGTTCTTGAAATACTCCACCGAG
CTGTCAATGCTCACTTCACGACTGCGCAGCTGGCGACGGTCAATATCAAAGCCCACGTAGAAGCAGACGCCGAACTTGCTGGGCTGCGCTGGGGTTCCGC
CGTTAGACTGCTCATTCGCTGGAGCCTCACCACCTGTCACAAAGTTCAGTGGGTACTTCTTCGTGAAAGCGCGCAAACGGCAAAGCGCCGGATTGTAGGC
GAGCGACTCCACCAGCTTACGCATACGAGACTCGCAAAACCCGCACCACGCCTGCTCCTCGTCCTGCTTCTCCGTGTACACCTCGACTGCGAGGTAGTGT
TGGTGGACGGCGAAAAAGTCCGAGGGCTCAAAAAGTGGCCCCCATTCCGAACCACCTTTGCTCAGCACATCTTGCACAATGGTCAGGCCGCGCTTAAACT
CCTCCTTCATAACCGTAAGACTGTGCGTCGACACGTTAAACGAGGAATTCATCGACGGGTACGCCGGCGTCAGGATCGGCATCACTTGGTATCTAAAAAC
ACATGAGCAATCATCCAAACTCAGTTATTCGTCTAGAAAAAAAAGCTGACAGCAATCTAGCCAACTCACCGGTTGTGGCCTGCGTTGGCGTTCCAAATTT
CCAACCCCAAATTGGCGTCCTGTGTCTTGCACAACTGGATAGCGAGCGGCCACTTCCAGTTGTTCAGCACCATGAAGAAACGCAGCAGCAGTGTCGACGG
AGCCGCGGTCGGGTACAGCTGGTTGATGAAGCACACCAAGATGCACCAATTGACACCTCCGAGGTAGCCCATCTTGTTCGAGTACAGTCCTCGACGTTTG
GCCCAGCGTCTCACAATACGGAGCACGCCGATGAAGCTCTCCCGGTTCGGGGTGAGCTTGATCATGAGCTCCGTGACTCGAGGGCCATTGAGACTCTTCT
CGGTGGCGGGGTCCACGCCCACAAGCACATGGTCGTCCAGAATATTTAAATTTTCAGGGATTGAGTTCCTCGGCAGGATGGCAATTTGTAAATCAATGTT
AATCTCCTCGTAGTCGAACGTCAGGATGGGCACGATGGCACCCTCAATAGCCACGAGGTTCGAGACCTTGGGGTGCTGCAGGAAAATGTCCTTCAAGGAC
GAGAAAAAGTCCTCGCGCGTCACGTGGCGCGGCGCCACGCAGATGGTGTCGATATCCGCGCCCGGTTCGTTCACCCCGAGGCGGTACGAGCCCGACACGA
GGATCTGGCCGCCGGCGTCGGCCGCCATGTCCTCGGGCACGCCCTTGTCCATGCACACGCGCTTCACCCATTGGCGGAAAATCGAGCGCAACTCGGCCAG
AATCAGCGAGCGGCGCGTGATGTTGGCGTCGGATTCCGTGGGGAAGTGCGCGTCCATGAAGCTTTGCAACTTGGCCGACTGCTCCAGGTCCTTGGGCTCG
GGCGGCGTCGTGCGGATGGCCTTGTACGCCTGCTCCAGCACGTGCGGCGCCACGGTGAACGTCGCGCTCTGCATGACGAGAATCGGCGAATGAAGGCAGC
CTGTCCGCAGTCCGTTTCGCGCTAATCTGCTTGTGTCACTCAAGGTGAACAATGCCAGCGCTGTCTCTGTGTCGCTCATTGGCGGATAAAGCTTCTAGAT
TTCATTGGTGGAAAAGAAACATTATTTTATCGACCAATCAAACAACATTTGAAATTGAATTTTGAATTTGCAGCACTTCTCGTGGCCGAGATGGACGACA
TTGAGGCGCTCATGCCCCGCACCAAGTACGTGCGTGTCCCCCTGGTGCTGGGGGATACAAGGCGATAATTGCTGATATATTGTGTGTGCAGAGCGGCTAA
TGACCGAGCGCCAGTGGATGGGGCCAAGCTGCGACAGTACATGGCCACCGCCAACACTGAGCACGTCGGAGCGTACGGAATCTTGCGGTCATTTATCGTT
TTTTATTTTCTTATTTTATGTTCATAACATTGTAGCCGCTCCGGTGTCGTGGTGCGCGGCGATGTACGCAAAGACGCTGAAGGGTTCGAGGACATTGACG
ACTTTTGGGTCGACGAGGACTCGCTGCAGGACGACTCGGTGGACGATGACGATGACTGTGCGCGGCAGTGGCTGCAATTTGCAGGAGGATAAGAGATGCT
GACCCTGTTTTTTAATTTTATTTTGACAGCACTCACGGTGTCCGATAAGGATGAGGCGGATACGTCGGGGGACATATCGGAGCCGAGCGAGCATGAGGTG
GAGCTGCCGGAGATTGACAGCCCCGTGTCCAGTGGCAAAGACAGTATAGACATTGAGCGAGGATCGATTCCAGCGAGATCGCAAAGAAGCAGTGACAGAG
GGATTTTGGATATTGAGCGAGGCTCGATTCCAGTGGCATCGCAGAGAAGCAATGCCCGAGCGGAAGAGGAGAAGAAGGTTGGTGCATCTGAATCGCCGCC
GCCGTCCCCCGCACGGAGCGATATTTCGTTTGATTTTGGTGGCTCGCCGCATGGCTCCGTGGATATGGATGCAAACATCACTGTGCGTGATCGACGCGGC
AAGAAGTCTACTGGAGCTGGTGGGGATAAGGCAAAAACGAAGGCTCGCCGGCGAGAATCTTCGGGCGCCGTTCGCGGCTTTGATGAGGATGCAGCGAGTC
CGTTTTCTATGAACGATGAGCCGGTGACTCCACTGTCAAACGGTGCGTGGTGCTTCCGGGTTAATGCATTTTATTTTCAGCGATGACTCATTATACTGCC
TTGTTTTTTATCTTGCTGCAGCGAGCGACCGTACGTTGAAGTCAATTCCGTCATTTTCGGGAAAAGACTCGGTCTCGCCGACCATCACCAAGGAGTTATT
CAAGGAGGGGGGATACCGCAGCGATGCCAGTGAAAGAAAACCGAAGAAAAAACAGACGAAGAAGCCGAAAAAGGCTGCGGATAAGGGTGGTCGCAAGACA
CCGCGACTGCGCCCGACGGGAAAATATGGCTACCGGAGTACTCCACCCGCAACCGATACCTCGATCCAGTCCGTGCAGACTGACGATGATAATGACGAGT
CTTTCGAGGCGCAACACGACTCTGGTGGCGAGACAGGAGATGACAGCTTTTACAATGAGCCGGACGCGCCGAGTGGCAGGGTTCGAGACAGGTTACCTGA
CGCCTCTAGGATCTTGGATGACGACGAAAATGATGAAGCTTGGGATGGCAGTGGCCTGCGTCGGTCGAAGCGGAAGCGTTACAAACCGCTTGCATGGTTT
AAGAGTGAGCACATGGTGTACGAACGCACCTTTGTCGGAGTGGGAACTGTGCTGCCTACGGTTGTCGGCATCGAACGTCTCGGTGCTGATTCTCCAACAT
CAAAACGGACGAAGTCTAAGCCTCCGTCGAAAAGGACGAACAACAGCAAGCCCTTGAGACTGAAAGATCTGCCCAAGGACGTGCGAAAGCGCATCGTGGA
TAGCGAGTGGGCGACGCTTTACGACGGTCAGGCCGGTTGCATGAACGACCTGAACATCATCTGCCGCTCCAGTGAGATCCGTCTGCGTAAGCTCCCCACG
GAGGAGAGAGGCGGTGCAGTCGTGCACGCGTACGCGGGGCAGAGTTTCAACCTTTTTAGTCCGTCCCCTTTTGCGCGGTGGATCTCTGGACGTGTAGTAT
TGCCTCCCGGCGCGTGGAAGGAACCAGAGGGTGTTGGTCAAGCCGTGCAGTTGTTCTACGTAACTGGATGCCAGCCAAAGTCGCTGGAGTTGGCGGTGGC
GCCCGAGACCGATGACGACTTTTTCACCAGCAAGCACACGACCCACTTTATGCTAAGCCCAGGCGACGAGTTCTACGTGCCGTCTGGTAATGTGTACTAC
GTGAAAAACCACTCGGGCTCTGCGGACTGCGACTTGCGGTTCACGATTTTAAAGCCCGAGGCGCCGCAAATGCCATCCGACAACAATGACTCCGATGCGG
AGAAGGAGGAGACGAAGCCTGATCCGGAGTCAAAACCCGAAGCAGCAGAAGCACTCGACAACGAGCTGAAGCGCAAGCGAGAGGAGGACGTGGACTCGGA
CTCGGTTTAGAGCGGTGTGCATTAGTGCTAGCAGCAGCAGTCTCCTTTATTCAGTACTTTGAAGTAGATTTGTTTCCTCTTGTTGTGGTGGACCGTCTCC
GTCGTGACATTGCTGTCACACAGTAGGACGAGGAGCCGGAAAACTGTCTGACTCAGCCGGATAAAGCACCGGCTCCTGATTACGATCGATACGGGCATGG
CATCTTCGTGGTGGTCTCCAATATGTAGCGGCGTCTCAATTTCAGAGACTCGCATGGCAAGGAAATAAAACTACCATCGCCATTGGGTTTTGCGGCCAAG
TGTCCACACGCTGTGACGGTAGCACGTTACAGCGTTTGAAGTTATGCGCGAAAACGACGTCGTGGGCCACAACTGGTAAAGCGTCGTCAACTCGAGCGGC
GATCTATGCGCGCACATGCGCATGGGCGCGGGTCTGCTATAAAAGCAGATGGAGTCTGCACGCACGAAGCCTCTATGGGTAGGTGAGCGAGCACAGCTGG
AGGGCCTAAGAATACGCGTGGCGCGTGGTTCGGTGTCTTGGTGTCAGACCGAAAGAGAGGGGACGAGGTTGTCAGTGGCAAAGAGACTGAGTGTCGGACA
GCCAGAACACCAGCAGGTGCCGGCAGACTGCTGCCTGTCCTATACTGCCCCGCTAGCTTTCCGTGTTGCCAGCTCCCGATTGCTTATTTATCGTTATTGC
GCGTCGATCAGCTTGATTCGCGCTATGGATCCTGCAGCTTCATCGTCCAAGTGCGTTCTCAGCTTGCTGGGTACTGGTTGCCAACTAGATGTGCTGCTCT
TTACTGACGTATGGGCTGCGTCTGCGATAGGATGGACGACGTCTACGAAACCATTAAAGAAGGAAGCGTGGCTGTCCGAGGGCATTTCATGGTACGAACG
AGTCCAGTGTGGCATGAATTGATAGGAATATCGTGGTCTCACTTGTTGTTGGCCAACTTTGCAGTGGCGTGATCGCTACGTTGGTATCAAACCAGGCGAA
ATGATCATTCGTCGCCGTCGAGACGGCACCATTAAAGCCAAGGTTTGTGTCACAACTTCGTTTATCGAGACCAAGCTCGTTCTCATTTGTTGTTGCTGCT
GTCAGATCGACTTGCTAGACACCAATATCAAACTCACGTTCCTCGGCGGCCAGTCCTTGCTTACCATCGCTATGCACGGACGGGATACTGTTTTGGACTT
TCGCTCTTCAATTACGCGTGACGAGTGGATCAGTGCTATCGTAAGCGCACAGGAGCGCCCTGGCTCGGACGCTGACTGCGACGACGATGGAACTGAACTT
CTTTCTGGCGAAGAAACAGACGAGGGACACAAGCGTAGCTCCATGACGAGCTTGGGGACCGAAAAGACCGACTCCATAGCGGAGGATAGCTACAATGATG
CACTACTTGCATTGCAGAGCGTACGTGATTCCGTAATGCAGTGTCATCTCTCGATGAGCGCAGCCGAGGTCGACTCGTTCATTAATCCTTGCGATAACCC
CATCGCAGCAGCAACCTCAAAAACGATTCCTTCACTACGACGAGCCCAAAGCGCGACGCGCAGTGAAGAGGAACTTCGACAGAAACGCCTTCGAGCACTG
CTGACGATGATCGAAAGCACGCCTCACGGAGGACGTGTTGTGCTCTTGCACCTCGGAGTAATTGCGTCTGCAGGCATCACTGTTGGCGATATGCTGTTGG
CACTTGGAGAAAAGCAGCGGGAAAACCCACGTCGTGGCTCCTTCACTCCGCGTACGCTGAGTGCCCAAAAGCACAGCATTGCGGCGTTTGTGCGCGATAT
TTTGTTCCACCCCATTTACTCGAAGCGCGAGGAGGTCAACACCGAGATTGTTCAGGGGCTCATCGACTTGTTCTTCCCACATTGTCGGTTGAGGCGGTTT
AGTGATGATACGGAGTGGCATCAAGTCCAGCCGTCGGCTTCGGTAAACAACACATCCAGAGTTACAACAAAAAGTGAAAATGATGCTGACGTTGGTACTG
CAGTTCCGACAACCCCGACCGTAGCACCGCCAACTCCTGCATCGCGTCTTCAGAGGCGAAAGCGACGGAATCACTCGTTCCCGAATCTGGGTGGTATATC
TCAACTCACCAAGAGCAAGGGTTTGAAACAGACCTCGGTCGATGACAACGACCGATCTATTAGCACGCGCAAGTTGGAGGAAGGCAGCCAACGGCTACGT
GACAATCTGTCTGTGCTGTTCGCACCATTCCCAGACAGCAAAGGCCCCAGCAGCGGACCAACTCCGTTTGTGAGTATAAGCACACCATTCGCCTCCGACT
CATCTGATGAACTCGATGTAGTATGCGAGGACATACCGCTCCCCCAGCCATTGCGGAAAGTCTTGTGGGAAATGTCGTGCTCAGAGTTAGCTGAGCAGCT
CACGCTTTTTCATCACTCCCAACTCTCGAACGTGTATCCGTGGGAGTTTTTGCACCACCCCAAAGAAGCTGCCATGGAGTTGACCGAGAACTTCAACCGG
TTGGTAGCATATTTCGTCTGGTCTGTACTGGTCGAAGACTCTCCAAAGGAGCGCGCAGAGGTCATTGAGAACATTATCTCCATTGCGATGGCCGCAAGTG
CATCCCCGCTTAATAACTTTCACCTGGTCATGGCTTGCGTGGGCTGCCTCGGAGATACGCCGCTGATGTCTTCACGGATGCCGATCACGTGGAAGAAAGT
TCGGGCCAAGTACAAAACTCGTCTAGGTGAACTTCGACGGCTGTGCGACCATACCGGCGGCTTTGAGAACCTGCGACGCAAGCAGAGCACTGAAAGTGCA
CGGCCCATGCTTGCCAGCGACGTATCGACTGTCTCCATTATTCCCTTCATCGGCGTTATCGGGGTCATGCTGGAGCGATTGCGATCAATCAACTACTTCA
CCTCGAAGAAGATGTTGGACTTGGAAAAACTTGAGCGGCAATACACGGTGCTCAATGTACTCGAGAACGCGTTGCTCAAGCCCGCTCCACGGCCTTCTCG
GGTGCCTCAACGCGGTAAGGTAGCCCCCATGGAATCGGCGACGGAAATGACAGCTCGCTTGCAACATTTTTTCCGGACACTCAAAATGGACTTTGCCTCG
CCTCGACTGCATCAGCTACGCTCGCAGCAAATTTTGGCAAGCGAAACGAGCTCCACGAGCTCAGCGTCGGCTTCTTTTGTATTATCAGCAACCGTCAACG
GGAGTAACAGAGGCGGGGCCCCATTGACTGCAACGACCCTGGCAGTGAGCAAATATGACGCGCAAGGTTCTGTAGGTCCAAGTGAAGACTCTGGTTTGGC
ATTCGTGTCCTTCCGAGACATTTGCGTGTTGTTAGTGTCTGTCCCGGAGATGCGTGAGCGAATGCAGATGGCTCTCGAGGCGCTCTTCGTAGACGGTCGT
CAGCCAGCAACGCAGTTCCTGCGCAAGTTTTGGCTCGATTTCAAGCAGAACGTCTGGGTGTCCGGCGTCGGCCCCACGCTCCAAAGCGTACGCGTCTGCG
TGGCCGCCCTGTACCAGGAAGTCATGGCGCACAAAATCACCGAGCTCATGCAGATCAGCGGACTAGACGAGAACTCGGCTGAGCTGCACGACGTGGTGTA
CGCAAAGGCCGTGGTGTTGACCGTGCAGCCTATTTATCTGAAAATCGTGTCCAAGGTCAAGCGCAACTTCGTCAAGGAGGACGCGCACGCAGCAGCACGC
CTGCTACAGAGTACGCCAAAGGTTGTCGTCGACACGAGCCTGCCGACCATGCCGTGGAGTAGTTGCAGCTGCACTTCTCCCGTCGAGTTGCTGGACCTCG
TGTGCCAGTTGACGACGCTGCCTCGTGCCAGCACCACCAGTGCAGCCACCGCTGCGACCGACCACCAGCTCGCGGCGGTGGAGCTGCTGGGCGCTCTGCA
GCATCAAGCGCGACACACCTTCCTCGCCACGAACCCGGTGAGCAGCTTGTACCTCATGAAGCAGATCCTGGACCCCAAGTACCTTCCTCTCGCGCGACGA
CAAGCGCTCGAGGTCTTTGTCGCGGCGGTCACGTGGCTGCGCAAGGAGCAGAAGCTCTCCTCGGACGAGGCGCCGTGAATCTTCCAGCGATTGCACGCGC
ATGTACCGGTACAGACAAGGCCTGAACGGATGACAGCCTGGTGACGCCCGACGCCGACCGAATGAGTGCACGCACACGTTGTTTTATGGCAGCGCATGTT
TCCTACAAGAGCCATCCATCCCCACTGAATTTCGGAGAGATGGCCAGAATATATTATCTCGCGCTTGCCATCGTCCTCGTATCGTATCGTCCTCACCGTC
TTGGCCCATTGCCCCGAGAGTCAGGGCAATGTGCAATAAGCAAGTGAAGGTGTCAACGAACTTCCAGCAAAAAAGTATCTTTTGTAGCACTGCATAGCCG
GGGCGGACGTCCTTTCGCCGGCCAATAGAAGCGCCGATCTTGATGCGCGCCGATTTTACCCACTCATCTCGCTCGATGTCGCGATATTCCCATTGGCTGA
AAACCCGCACAGTGGGCGCACAGTAAGCGTCAAAAGTTACGGCTCCATGTAGCGTGGTGTCGTCGCTCGCGACTTTCCTGGCGGAACGAGCGCGCACTCG
TCCGCCAGCGCCCCATACAATTCCCTCCCTAGACCTTGGGCGCAAATACACCCCCCTCTGATACGCAGCCACTTCAGCACTGAAGACAGAACCCCCTCCC
TCGATTTAATAACCCCTCGGGTATGCGCGTGTGGACTCTGGCGCTCGGTCTGCTGCACGCCGCGTCGGCCGCCAGCTCCTCCGGCTCCGGCGCGAGCGGC
ACGCGCAACACGCTCACCACGAGCTGCAACGGCGGATGCAGCAACGCGTGCGTCGTGGTGGGGCAGTCGTCGGCCAACGCCATCGACTGCGTGAACGACA
CGAGCTGCGTGACGCTGTCCTCGGGCCAGTCGGCGCTGTGTCTCGACGCCTTCGCCTCATCGGCCACCGAGTGGACGTTTCAACCGGCCGAGAGCAACGA
CACAGCAGGGGCCGGTCCCTTTGAACGCGTGGGGCTGCTGCAGCTGGACGGCCAGGTGACAGACCTCACGTTCGCCAAAGCAGAGCAGAATGAGGAACCG
CTCTCGGGAACGCTCGAGCTTTCGTCCATGAACATCCAATCGGATGCGACGCTGGACAAAGTGGCGTTCAGGAACTTGAGCTTGTCCGGTTTGGACAGCG
CCTTACCGCTCAACAGCGTCAGAAGAATGTGCGTCGCTGTGATGTTGCACGAGGAAGAAACTACCACGACTGACACTGGTATTTTATGTGGACAGATATT
TCAACAACTGCTCCTTGAACGCCATCCCTACGGCTGCTGTGGCTGGAGACTCCGTCACTGTCATGTAAGAGCACATTCGATGCACTGCTTGCAGAACTTG
TTCTAATTTTCATTGTTTGTGGTGCAGTGATTTAGCAGGAAATGCCATCGCGGGGGTGGAGAGCGATTTCCAAGACGAGTCTTTCCCGAATCTTACTGTA
CTGTACGTGCCAACTTCTGCTTTAACCTAGACTGCACCAACATTGCTAACTGAAACATGGTGTCTTTCGTGCAGTGATTTATCGGCGAACACTCTGACGG
ACTTCGACCTCGTGGTAGACAACTTTCCAGCGATCACGACCTTGTAAGTTCGCCTGCGGCGAAGTGTGCGCTGCTCGTAGCAAGCTTCCGACTCACCTTC
CTGTATTCGTGTGCTTAGATTTCTCCACGACAACTCGCTGGCATCTGTTCCCGACGTGGTCTTCAATTTGTCCACACTCCAGCATCTGACGCTGGCCGAC
AACCCTATCAACGCGTCGGGTCTTACAGTGGACCAGTTCGCATTCCTCGCGAATCTGAACGTGTTCACTATGATGGCACCACAAACACGAGCGCATGCCC
AACCTCCGCTGTCCAGACCGCGCTTAACGAGTCTTTCACGTTTTGTGCGGGGAATGGAGACGACATAGAACCCTCAAACGCGACAGTCACGGAGATGCCA
TCGACTACGGTGCCTTCAACAACTGAAGGTGCTTCATCTTCCTCTTCGTCGCACAAAACATGGATTATTATTGGGGCGTGTCTGGGTGGCGTGGTGCTGC
TGTTGCTGATCTTCTTCATATGGTGGTGCTGCCGTCGGCGGAGGAACGAGCAACCCAAGCTCATGAACAGTACAACTCCATCAATTGCAATCGGCATGGG
CGACTTGTCTGACCACCCCTACATGGAATGGGTGTTCCTCGATCCACCAACGCCTCTAGCCAGACGACGTCGGACTTTGAATTATTGGCGTCTGTGGCAG
ACGGCTATATCGGACTTACTCGGCTATCGTATGACGACGTATTCCTGCACAAGATGCTGCGTGTGAGCAGCCGTTCGGAGCTATGGCTGGGCGAGTACAA
GCATGAGGTTGTGCTTGTCAAGAAAATCAAGAGCAACACGGCATCAAAGGCGTTGATGCGGGACTTCGTGACAGAGATCGAGCTGATGTTCGAGCTGAAA
CACCCTCGCATTGCAGCCTTCCGGGGTGCTATGTGGGATGCGGACGGCACGGAGCTCTGCGCTGTGGTCGAGTATGTTGAAAAGGGAGCGCTGCGTGATT
GCACGGTTAACAATGCCATGGAGCTGTCGGTGCCAAAGCAGCATACCATTGCTCGCCAGATTTCAGAGGCCATGGCTTTCCTTCACAAGCAGAACATTGT
GCACGGCCGGCTGAATGCGTTCAACATCCTTTTGGACAAGGAATATTCCGCCAAGCTTAGTCTGTTCAGCATTTTCCACTACGTGAAGCTTTCGCCTTTA
GACAACGAGTGCAAGATCTTTGCCGCCCCAGAAGTTCTGCGCGGTGAACAACCAACTGAGAGATCTGATGTATACGCATTCGGCGTAGTGCTCGTGGAAA
TCGACACAGGTGAGACCCCAGTGATGAATGCTCGGAGGCTATCGATGGAGCGATCGGGTCGCGAGGATGCTCTCTCTCCAACCGCCAAGAAGACTGGATT
CCGCTTGAGCCGCCTCTGCTCCGGCGTGATGAAGGAGATTATTGCAGCCTGTCTGGAAAAGGACCCTGCACGACGTCCATCAATGGCTGACGTGGCATTG
GCTCTTAAGACTGGAGCGATGAAGCTGTGAGGACTCGCTCAGCAACGAAGGCAGGCTCGACACAAGCCACTCTGGATTTTATTTTCTACTACATGTACCG
GTACTAGCCTGGACACACGCCAATAGCGTAAAACGCTGCTGCATGAAGCAGAACTCGCGGTAGATGTAAGCCCGAACTCATGTAAATGGGAGGCAGCCTC
CCTTATTTTTACCCGTCAGGAAGCACAAGAAGAGCACTAGCCAGTTGTCGCTCTTTGTATAAAAACCACATAAAAACATTTAGGAAGCTGGTGGTTTTTG
CTGTCACGGGGACAAAGCGAACAAGGTGAGTGTACGACAGCATCAAATTGGGAGCAACCAATGTTATGACTCATCTGATTGTCCAAACATATTGAAAGAA
TTCTCATGCCTGTCAAGTTGACAATCAAGTCAACCAGTCGATTCAGCCCTGGAGTCAAAGCCAGCGATGAATGGCATCCTTCGCTGGCGCCGCATCTGTT
CCCGTGTTTCCAAGACACCGAAAGCTTTCTCCCCGTCGTTTCGGGGGGTCGTGCTATTCATGTATGTACACGTCATTTCGATTTCCTCGCTAATCACATG
CAAACACGTTAGCAGACATTGCCGTGCCTCAAGCGATAATGCAACCAGTAGCACATTGCATGAAAAAATTGGATTGCCTTTTTCTACAAGCTCGAAGTGC
GCCAAAGCTATCATTGTGCCAATAAATATTCAACGCGCCTCCCTACTCCTACTCCTCCAATTCGCCCACACAAAACGCAATCCAATGTGCGTGGAGCTGG
TAGAAGTCTCCTATGATTTCCTATGTGCGCGCTCGGGTATGAGCGGCAATCACCATCATCGTTTCACAGATTTGGGCAAAGCGCCAGTGCTGGTGGCTTG
ATGCAAAGAGCACACATTACCATTGCGCTCGTAAGCAGGCTTGCGGCAGCCTTCCACAACACATCGCTTGCCTGTAAGAAAACAAGTGAGAAAGAGCAAA
AATAAGCAGCAGCACGCAAAAGCAACACAGCGAAAAGAGAGCTCTGTGTGTGAGTATAACACGATCAAGAACAAATTGCTTGAGTCAAAGTAGTCATGCA
GCTCACCTCCTCCGTGAGCCCAGCAAAGACCGTGGGAGACTGCCGTCTTGGTACAGTTTTGTTCGCTGCATTTGCGACCTGAAAAGGAAGCGGAATTCAA
GTGAGTTTTGCATGACCTGTACGAATGAAAGGTAATCAATCAGCACTGCACCTCCGCCGTGAGACCAGCAGACGCCGCGAGACTTGGCACGGTTCTCGCA
CCCCGCCACGGTGCATTTCGTCGAGCCGCCTGCAATTGTTGCGCAAGGTTTGGTAAGCAAATCATGAAGCCACCTTTTTCAATAATCGTGCTTGCCTTAC
CGTGCTTCCAACACACACCCAAATTTTTAGCACTGCTCGTGCACCCCACGACTGCACATCGCTTACCGCCCTGTTATCAAATCAAGCATTCGGTCAACAT
TGGATCCAATGCGAACAGCGAAACACCGCACAACTGCCACCCACCCCGTGACCGATGCAGAGTCCGCGGTTCACCACGTAGCGCGTGCAGTTTTCAAACT
TGCAGATCCGCGACTTCTTGATCGCAGCTTTGGCTGCTGCGGGCGCCGGCACATTGGCCTCTCGGTTCTCCGTCGCCGATTCGTCCCGAGGGGCCCCTGA
ACTAACCGCGAGGTCCGCTGCAACGCACCAATGCAGCAAACACCGACAAGTCACGCTCTGCAAATCCAGTCGGTCGTCCGCAAGGTTGCAAGGATCAGCG
CAACGTACCGAAGCTCGACGTTTGGTCCTCGTCCGAGCCGCCGAGGATGAAGGCGAGCGAGCTCTTGCTGGCCGCGGCCGTCGCGTCCGTGTTCATGATG
GCCTCGAGGCGGTGGCGGTTGGCGGCGACCTGGAGCTGCTGCAGCGCCGGCAGCGAGGGCCCTTCTCGCACGCCGTGCCCATCCTGGCGGGGCTCGTTGG
TCGCCACTTGGTGGAGCCACGCTGCGCTCATGTCGACGTCGTCGCCGGCCGAGTTCTTCATGCAGGAGGCCGGATACAGCAGCATCCAGAGGGGGCAAAG
TCTTGAGATAGGGACCAAAGGGGTGTGGTGGTATTTTATTCTAGTGCTGCCTGCTGCTGGCAGAGTCAACTGTTCCAGCAGTCAGCCGGTTGTTATCTGA
ATAATGGACTGCAAGAAGCAGTCGATTCAAGTCGACGCCTGCCCCGGCTGGCGAGAGAAAAGCCCCGAGCGCGGGCCGATGGTGCGTTGATTGCTGTGGC
CGCGTCACTGGAGACTCGAACCACTGGTGTCCGACAGGCTCCGCTATTGATGCCGGCTCCGGCTTGCGAGCACTTGCCCTTTGTATGTCGCGCGGCGAGG
CCAACGGATGGTGGCCAAAATTGGCCCCATTTCGACCAATCCAAAGTGGGTACACAGCGCCGCTTCGAGCTTCGAAATCCCGCCCCATACTGGGGCCAAG
CTGTTTTCTCCCAAGATCGCGCGGCTCGTCTCT