Description :
From Genome Similarity Track
Location :
Scaffold_62:133293- 135777
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_10522transmembrane protein, putative

Sequence
2484 bases(100 bases per row)
TCCAGATCCTGCCTGCTGCTGCGAGAAACGACGGGGTTATTCTATCGCAAACCAGCTTGTCAAAGTGTGATGTTTAAACATGCATTTCCCATGGGTTGCA
CGTCTACCTCGTATGCAATCTGCGTCGTGGCGCAGCTTCTCGATGCCAAGCACCTGATGATCTGCTGTCGCCAGACCATGGCCGCTGGAGAAGATCTCGC
ATCTCGTCCGGCACGGTATCCAACCGGAATCTGGATTCGGAAAGGCGCACCTACTTCAACCTTTGGCACACGAAAGGATTCTGTAGGATACCGGAGTTTC
AATATTCCCAGCCGGCAGCATGCAGAGCGACGCAAGCCCTGACCGTCGCATCTCGTTCGACGACGACGACGCTGGCACGTACTCGGTGCTCATGAGCCCA
GCGGCAGGCGCGCTGCCACCCAAGCTACCGCTCTCGCGCGTCCGGCCGCCAACGCGCCATGCGCCACCGTCGCCACTCGACACACGCTCCATGTGCTCTG
CCCACCAACGTACATGGCTACACTTGCGACGCCTTAGCATGGAAGCGATGTAGGTCCCCACTCGGCGGTGTCGAGCACGACGAGCAAGGCGCCAGTGCTC
ACGGAGCTCAACGACAGCATCGTATTTGCCCTGCGGCCTGCAACACCCGACGCCAAGAAGACGAGCGGCAGGACGACCAAGGTCGCCGACTTGAGCGTCC
CGAGCGTCTCGATTCCAGAGAACCAGCGGTCGGATCTCGCCCGATCTCTTCGGGTCCTCATGTGTATCGTCTAGGTACACGTTTGCAATCATTCTGCGCA
ACACGTACCAAGTCAAGCAGCTCCTCAAAGAGCGGTTTCCGCGGCGCGTGGACAAGCCGCTGCGGCGCCACTACGCAGACCAGGTCGGCGCAATGCAGAT
CAAGTGCATTCGGCGGCTCGTGCAGTCGGGGCTCGGCGTCATCCTCCTCGACAACGACAACAGCATCCCGCACCATGCGCAAAAGTGGAACGAGACCAAC
AACATTTGCGTGCTCATCGACCCGTACAAGGTAGAGCATGTGGCCTGGATCACGCGATCGATGGCTTGTAGGACAAGGAACTGCTGTTGCAAGAGTTTCG
GCGGGAGAAAGACGAGCTCGCGATCAAGCGCGGCCAGGCGACGTCGCGCTTGGGCCTCGAGACGCTCGAGAGTCTTCGAAACGCGTGCTTCTCGCCGGCG
CTCGAGCTCCAGCTGACGCACAACCTCATCCGCAACGCTCTGCGCGACTACGACGTCGAGGACTGGGTCTGCACTGTCCCACGAAAGTAATATCCATGTA
TCAACTGTATGGCAACAGGTGCTGGACCACTCGAACGAGCTCTCGTGCTGGGACGTGATCGAGCACTGCTTCCCACTCCACGACCGCGTCTTCAACAACA
CGTTCTTCGCCGAGTACCGCAAGCGCACCTTTGACGTGCGCAAGGCGGCAGGCAATTCCTCGGAGCGCTGGGCCATCGAAGGTCGAATTGCGTTTTTGTA
TCAATCTTTCAAGCAGATGTTCGTAGAGCTGCGGCTGCACTTTGGCGAGCGCGTCGCGTTCCTCTTTGCCTTTATGCGCATCTACAGCAAGATGCTTTTG
CCGCTCACCGTGCTCTGCGTCCTCTATTACCTCGGGTTTCGGTGGGTGCCCGGGTACGTCTGGAACAAGTACCTCCTCGGGCTCTCGGTGCTCGGGTTCG
GCGTCGTCGCGGTCTGGGCGCCGGCGCTCATGCTTGTCTGGGAGCGCGAGACGCGCGTGCTCACTGAAAAGTGGAATTTAGCCAGCTACCGCGACACGAT
CTTTGAGCGCAACGACGAGAACCCGGCCTTTGAGTACGTCTGGACCAAGAACGAGATCACGCACGAGATGGAGAAGACGCCCAAGGAGAGCAAGAAGCGA
CTCATTCGCGCCACGATGGTCTTCTTCGTCGCCCTGAGCTCGCTCCTCCAGTGCATCGTGCTCATGCCCTTTCTCCAGGTACTGCGAATACGCCTCTGCA
TCCCATCAAGTGATATATTGCGCTGTCCTCTAGTGGTATGTGTGGTCCAAGCTCGCCCCTGTCTGCGACGGCAGTGTGTGTGCCGAGCGTGGCAACTGCC
GGCAGTTTATCAACTGCTTCCAGTCGCCCACGTCGACGGTGGGCACGGACCGCTGGGCGTACATCCTCATCCAGGTAGCTCCGCACCATTATACATATTC
AATACCTAGCAACGAATAGGGTGTCTTGCTCGGGCTTCTCATCGACACAGTGTTCTTCGAGCTCTTCAACTGGTTCTCGGCCAAGTTTGTCTCGTGGGAA
AATTTGGCGAAAAAATCCGACTTTGAAAACCGTACAATTCCTCCACTCGGCGAATTCACAAATGTTGCGACTAGGGCTCGTGCACCGGCGGTTCGTCTTT
GTGTGGTCCAATTGGTTCTTCTGGTTCCTCACACTCGCCTTCTTCTATCTCCCGTACGGCAACTACGTCAACGACCTCTTCCGG