Description :
From Genome Similarity Track
Location :
Scaffold_146:13329- 15773
Transcript NameFunction/comments
Phyta_totarag4525hypothetical protein PHYSODRAFT_285513
Phyta_totarag4526hypothetical protein PITG_01582

Sequence
2444 bases(100 bases per row)
GCTGTGATCTGGCGGATAATGGCCTGAATCTCGGCCatgatctccttcttgggcttggAGGCAGCCGCACTACCACTACAAATAGTACACAAGGTTTTTG
TCAACAACGGCTCATCAACAGCGGAAGGATACTGCTCGTGTACCTTTCGTCTGTGCCGTTCTCCGCGTGCACTTCGAACGCCCACCgctccagcacttct
tgCGTCTCAATCCCTGTGAtgaccagcaccagcttctgcacctcACCCTTCAGAAGCCAATCTGACCGTAGCAATATAATTTCTTGTAAGTAAGGCAAGC
ATGCTACTGTAGCTAGCGATGCATGCAGACGTACTCGACAGCTGGTGGAGgaacttggtgaagaagtcgttgaGCTTGTCATCGTCCGTGACTAGCATGT
TCAAGCCATACTTCTGGACCTGCTTGAAGCTCTCTGCAGGGTAGATGCCGCGCTGGTACAAAATGCTGTGGGTGAACACAAAATATATTAACTCATTGCA
GTACCACCACAGCCAATAATGTCTTACACCGCTCGTACGTGTTGATGCTGTACGAAAAGAACTCCGTCACGATTTCGGTCGAGCCCTTGAGTGTGATGAG
GTTCTCCAAAATCTGTGCTGTTGCCTGTGGCAGCGCATCATAATCGCCATGCAAGTACATAAATCAGTGCCAATGCCGCAGCGCCAAGGTCATCAACGCG
CTGGTaccatcttgctgctcttgatCGACGCAGTTTGGAAATGTGAATCAGAGTGTCCACCACTCCAAAATCCTATCAAACAGAATGTAGAGCCTTTCAT
AGTAAATATGTTGCAGTTGAGACCATCATTCTTCCGTGTTCCATTCCGCATTGTGCACACTTGGCAGCAAGATGACACGAGCTCGAGCCCAGGTATCCGC
CCGGTGACGGATGCAGGGAGAAAGTATCTTAATCTAACGTTAAGtgtgagcagcgacgagaagaggaggagctgtCCGACGTGAGCGACGTTGAAGCGGA
GGACGATGAGCTAATCTTTATGTCGATTCTATTCGACCGAGGCGAATTGGGTGTCGCGATTTACAACGCGTTGACGACAAGtctcaagacgctgcagctt
ctaATAGTCGATCcacaggagctggaggaggtgaagTAACTGTCTGTTGTATCCGCAAGGGCGTAAAAAAACTGATCCGTGTCCTATGACGTAAATACTC
CAGATAATGGAGCGCCTGCATACACAATTCGAAGTAAACCACGTGCTTGTTTCCTCTCGGAATGCGAGTACAAATGGAATGCTTCGAATGGTCAAGAAAC
TCGACGAAACGCACCAAACGAAGACGGGGATCAGCGTCCGGAAGGTAATTTGGGCTTGCATTTTGCAGCTCTTTGAGATGCTTTCAGCTGACAAACACGG
GGCTTTGTAGCATTCAGGTAGTGCTTCCTCGAGTTGCGTCGAAATCTTTGATCATTCATCAACGACCCGTATCGCTTTGCCAAGCAGATTTCAACTACCT
AAAAGGCTGCCAAGCAATTGAGCATGTCCAGATCGGGGATGCCCCTGCTGAGTACAGGAAGCCTTATGCACGCTCGTCACGGTATCTTCCGTCCACTGTT
ATCACTGAAAAGGTTATGGGCTAAATAGTATAATTCTTTTACAGGCGAGAAGCGTACACGTTTCTGGGGAGCTTCTTCGATTTCGAAAGCACTCAGCTGA
TCCGCGCCACCGGTGGTAGGATTGAATCTTACACAttttgtgctgcttcaatcTTTGCTGTATATTTCGTGCTCAACTCTTTAATTTGTAGCCTTGCTGC
TCTACTTGTCCACCGAAAAGGTAGATTGGGTTGTTAAAGAGGGTGACGAAAACTCTAACTTTCTCGACTGTCATCACGCAGATTGGAAATCAATTGGATG
ACGTGGAATCCGTGTATTTTTCAACGGTGGAGCAAGTTGCACTCGACGGGTTCATGTACATCGACAAGACCACTCTCCAGTCTCTTCAGATATTCAATCA
TGTACGCAGATTTTGAGTAAGATTCTGAATGCTTGTACTGTGCTCATTTGTACCATTGTCCCACAGGAGGCACACCCATCCCTTGTCAAGGTGCAATACG
GTAAATGTAGTTTGGGATACTTTCTACTATTCTCACCTTCTTTTACAGGGACCTGGTCGAGCTAAGGAAGGGTTCAGGTGCTGTTTAGCTTACTTGAATT
GCTTTCGTTCTCGTGAACTCTGCTAATTGACAATTTTTGGTAGTCTGTTTGGACTACTTAACCGCACCGTGACCAAATCCGGCGGCTGCATGCTGCGCCG
TTGGATGTTAACACCACTTGTAAGCAGTGTCCAAATCAACGAGCGCCAAAGTTCCGTTGCATTCTTCACAGATACTGAAAACGACGAATTTCGGCAGCTA
CTGGTAATATCTTGCATATATGTTTTGATTAGTGAAACATGCAG